KEGG   Lactobacillus plantarum B21: SH83_01780Help
Entry
SH83_01780        CDS       T03680                                 

Definition
(GenBank) bacteriocin
Organism
lpb  Lactobacillus plantarum B21
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AJO73149
UniProt: P71461
Structure
PDB: 

Position
complement(380452..380619)
Genome map
AA seq 55 aa AA seqDB search
MTVNKMIKDLDVVDAFAPISNNKLNGVVGGGAWKNFWSSLRKGFYDGEAGRAIRR
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atgactgtgaacaaaatgattaaggatttggatgtagtagatgcatttgcacctatttct
aataataagttgaacggggttgttgggggaggcgcttggaaaaatttctggtctagttta
agaaaaggattttatgatggcgaagctggcagagcaatccgtcgttaa

DBGET integrated database retrieval system