KEGG   Lactobacillus plantarum WCFS1: lp_tRNA07Help
Entry
lp_tRNA07         tRNA      T00115                                 

Definition
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
lpl  Lactobacillus plantarum WCFS1
Pathway
lpl00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:lpl00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    lp_tRNA07
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:lpl03100]
    lp_tRNA07
Non-coding RNAs [BR:lpl03100]
 Transfer RNA
  tRNA
   lp_tRNA07
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1064221
Position
511350..511421
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
tgggctatagccaagtggtaaggcaacgggttttgatcccgtgatgcgctggttcgaacc
cagctagcccaa

DBGET integrated database retrieval system