KEGG   Mesorhizobium ciceri (biovar Biserrulae): Mesci_3856Help
Entry
Mesci_3856        gene      T01401                                 

Definition
(RefSeq) pseudogene
Organism
mci  Mesorhizobium ciceri (biovar Biserrulae)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 10119343
Position
complement(3985809..3987052)
Genome map
NT seq 1244 nt NT seq  +upstreamnt  +downstreamnt
atggctagatcgatcaacaatctaagcgctgtcgaagtggcgaagaaagccaagccgggc
acctacggtgacggcggcggcctttatctccaagtggcgaagagcgccgcgaagggtgcc
caggagggcgacgtcactaagtcctggcttttccgcttcatgatcgggggcaaggcccgg
tacatgggactcggggacgttcagacgttctccctgaaagaggcacgggaacgagcgcgc
gacgcccgccagaaggtcaccgatggcatagaccctattgaagttcggaaggagaagaag
gccactcttcgggcagaagatgccaagcgcgtgacgttcaagcaggcctcggagcgctac
atcacggcgcactccgctggctggaagaacgccaaacatgcggagcagtggcgcaatacg
ctcgcaacgtatgcgtggcctgtgatcggggacttgccggtggcaaaggtggacaccgcc
cacgtcatgcaaatccttgaaccgatctgggcgacgaaaaccgaaacagcgacccgcgtc
agaggtcgcgtcgaattggtgctcgattgggccaaggctcgacactaccgcagcggggac
aacccagcacggtggcgcggtcatctcgacaagctgcttccggcccggtcgaaagtcgcc
aaggttgagcatcatgcggccatgccgtacgcagggcttcccccattcatggctcaactc
cgctcaatgggaagcatatcggctcgtgcgctcgagttcaccatcttgaccgctgtccgg
actggcgaggctatcggggtgatggagggcgaggttgatttcgctaacaagctatggacg
atcccggccgcgcgcatgaaggccgaccgaccgcaccgcgtcccgctctcggatcgcgcg
atcgcgcgatcgagattttgaagagcgttccacgcgaggcggatagcccctatctcttcc
ccggcgctcgaaccgggaagccgctcagcaacatggcaatgctggaactgctccggggca
tggaaggaatggacggcctaaccgtccacggtttccgctcaacgttccgcgattgggcag
ccgagcgctcaaatttcccgcgcgaaatcgcggaggcggcgttggcgcacgtcatttcag
ataagacggaggccgcgtatcagcgcggtgatctgttggaaaagcggcgcaagcttatga
ccgcatgggccgcttttgcggataaaggggcaaagcgtgtctga

DBGET integrated database retrieval system