KEGG   Mycoplasma capricolum subsp. capricolum ATCC 27343: MCAP_0251
Entry
MCAP_0251         CDS       T00309                                 

Gene name
greA
Definition
(GenBank) transcription elongation factor GreA
  KO
K03624  transcription elongation factor GreA
Organism
mcp  Mycoplasma capricolum subsp. capricolum ATCC 27343
Brite
KEGG Orthology (KO) [BR:mcp00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03021 Transcription machinery [BR:mcp03021]
    MCAP_0251 (greA)
Transcription machinery [BR:mcp03021]
 Prokaryotic type
  Bacterial type
   Other transcription-related factors
    Transcription elongation factors
     MCAP_0251 (greA)
SSDB
Motif
Pfam: GreA_GreB_N GreA_GreB DUF4148 DUF4078 DUF4101 MerR-DNA-bind
Other DBs
NCBI-ProteinID: ABC01743
UniProt: Q2SSM5
Position
complement(305075..305548)
AA seq 157 aa
MSKEIILTQEGLEELKAELKNLLEVTRPKVIEELVEARNQGDLSENADYDAARNRQAEVE
ARIKEVETLINRAKVIDNSKTHSTGEVKIGSTVEFLSSLDHKTKEIKIVGAIEADPFSRL
ISNESPIAKAILGKKIGDTVEIKDILKPYKITIKSIK
NT seq 474 nt   +upstreamnt  +downstreamnt
atgtcaaaagaaattattttaactcaagaaggattagaagaattaaaagcagaacttaaa
aatctgttagaagttactagacctaaagtaattgaagaactggttgaagctcgtaatcaa
ggtgatttatctgaaaatgccgattatgatgctgctagaaatagacaagctgaagttgaa
gcaagaattaaagaagttgaaactttaatcaatagagctaaagttattgataattctaaa
actcattcaactggtgaagttaaaataggatcaactgtagaatttctttcaagtctagat
cataaaacaaaagaaataaaaattgttggagccattgaagctgatcctttttctcgttta
atttctaatgaatcaccaattgctaaagctattttaggtaaaaagattggtgatactgtt
gaaattaaagatattttaaaaccatataaaattacaatcaaaagtattaaataa

DBGET integrated database retrieval system