KEGG   Methylobacterium extorquens PA1: Mext_1897Help
Entry
Mext_1897         CDS       T00640                                 

Definition
(GenBank) hypothetical protein
Organism
mex  Methylobacterium extorquens PA1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABY30296
UniProt: A9W3Z0
Position
complement(2117259..2117456)
Genome map
AA seq 65 aa AA seqDB search
MTNDVPHPYSIAVEPLKKPEGQFGWALRKHGKLTERSDRTFTSEAKAFDNAMNAVERNVT
GYGSR
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
atgacgaatgatgtgccgcatccctattccatcgcagtcgagccgctgaagaagccagaa
ggccagtttggttgggccctcaggaagcacggtaagttgaccgagcggtcggaccgcaca
tttaccagtgaggccaaggctttcgacaacgcgatgaacgccgttgagcggaacgtgacc
gggtacggaagccgttaa

DBGET integrated database retrieval system