KEGG   Mycoplasma genitalium G37: MG_rrnA5SHelp
Entry
MG_rrnA5S         rRNA      T00002                                 

Gene name
rrfA
Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
mge  Mycoplasma genitalium G37
Pathway
mge03010  Ribosome
Brite
KEGG Orthology (KO) [BR:mge00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    MG_rrnA5S (rrfA)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:mge03011]
    MG_rrnA5S (rrfA)
  09184 RNA family
   03100 Non-coding RNAs [BR:mge03100]
    MG_rrnA5S (rrfA)
Ribosome [BR:mge03011]
 Ribosomal RNAs
  Prokaryotes
   MG_rrnA5S (rrfA)
Non-coding RNAs [BR:mge03100]
 Ribosomal RNA
  Large subunit rRNA
   MG_rrnA5S (rrfA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
174690..174793
Genome map
NT seq 104 nt NT seq  +upstreamnt  +downstreamnt
tgctaatatcgctgtggaaacacctggaaccatcccgaacccagcagttaagcacagtgg
agctaaatgtaggtagtaatactgagaataggtaagcaccaagc

DBGET integrated database retrieval system