KEGG   Mannheimia haemolytica M42548: MHH_c24600Help
Entry
MHH_c24600        CDS       T02635                                 

Definition
(GenBank) hypothetical protein
Organism
mhx  Mannheimia haemolytica M42548
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: SlyX RPW8 DASH_Duo1 DUF5089 DUF16 DUF1192 Nup54 HrpB7 Spc29 Laminin_II PhoU Sec20
Motif
Other DBs
NCBI-ProteinID: AGK02898
Position
2325794..2326048
Genome map
AA seq 84 aa AA seqDB search
MSRKKQKQTDSEKLDLILGGLNELNDKVDKQNEEIERLHREIQATNRLVNEMARKNRRDA
VVAGGLGGGIVAVGFELLRLKFGM
NT seq 255 nt NT seq  +upstreamnt  +downstreamnt
atgagccgtaaaaaacaaaagcaaaccgattcggaaaaattagacctgattttaggtgga
ttaaatgagctaaacgataaggtggataaacaaaacgaagaaatcgaacgcttacaccgt
gaaatccaagcgactaatcgtttagtgaatgaaatggcacgtaaaaaccgccgtgatgct
gtagttgccggtggcttgggtggtggcattgttgctgtgggttttgagttgttacgcctg
aaatttggaatgtag

DBGET integrated database retrieval system