KEGG   Mus musculus (mouse): 170942
Entry
170942            CDS       T01002                                 

Gene name
Erdr1, Gm21887, edr
Definition
(RefSeq) erythroid differentiation regulator 1
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 170942
NCBI-ProteinID: NP_579940
MGI: 2384747
Ensembl: ENSMUSG00000096768
UniProt: Q8VEL1
Position
X; Y
AA seq 177 aa
MPTGRTDGRTHGRTPQGRKPAPTAPLHPPQHTGHTRAPRPPRHTRHTRHTRQAGQAHASA
GPAAPATQTRTSRRGQDVHPPRSRCMCHRPSPRWTDGRTHARRQRPPVTAAAHSDVTHES
THVEADAVVKMSLPSPQDGRTDSTRCACRRGRQDGAILTEEGARQQGLTAYRNAPPQ
NT seq 534 nt   +upstreamnt  +downstreamnt
atgcccacgggacgcacggacggacggacgcacggacggactccacaaggtaggaagcct
gcgccgaccgcaccgctgcacccaccacagcacacaggacacacgcgggccccgcgcccg
cccaggcacacgcggcacacacggcacacacggcaggcaggccaggcacacgcatccgca
ggacccgccgcacccgccacgcagacacggacgagccgccgcggtcaagatgttcacccg
ccgcggtcaagatgtatgtgccaccgaccctcgccccgctggacggacggacggacgcac
gcacgccgtcagcgtccaccggtcactgccgccgcccacagtgatgtcacccacgaaagc
acacacgtagaagcggacgccgtggtcaagatgtctctgccatccccacaggacggacgg
acggactccacaaggtgcgcgtgtcgccgaggccgccaggacggagcgattctcacggag
gaaggagcacgccaacagggcctgactgcgtacagaaatgccccccctcaataa

DBGET integrated database retrieval system