KEGG   Mus musculus (mouse): 100040885Help
Entry
100040885         CDS       T01002                                 

Gene name
Gm16427, EG666058
Definition
(RefSeq) predicted gene 16427
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100040885
NCBI-ProteinID: XP_006535359
MGI: 3704103
Ensembl: ENSMUSG00000096044
Vega: OTTMUSG00000055692
UniProt: A0A0J9YU00
Position
5; 5 E2
AA seq 481 aa AA seqDB search
MSGQTPPTLQKRARQTQLRDEALAISPLESVPAVYVPWLFQEAFAGRHNSLIKTMVAAWP
FQYLPVGPLINMHNLETLQALLDGVDRRLTRKFPPGRPKLQVLDMRNVHHGFWNIGSDAN
DSDSDAETLDEKQVVKALPRYALRQRLKIIVDLSISSQLNEEKAYFLNWAKQRKGSINFC
CTKMKIWDAPDKVIREIMNVFHPEHITELELYTDWTLLRLAHFAPYFGQMKNLEKVFLAP
LHKNTSPIMNITGASKVKCIKKIISQFSKFNCLQHVFMKRVHFLRDHLHQILGCLRTPLQ
TLSITHCLISQTDLDSFSCCHNLFKLKNLEIRGVTLFALDLMPLRGLLGKLAGTLKSLDF
QWCSMKDSQLIVLLPALSQCSQLNQINFYSNDFSMAILKDLLQHTATWSKMNVEQYPVPL
ECYDALGHVSRERFVELCQELMDTLRAKREPKSISFATNVCQNCGKTCVYGQGARLCSCL
Q
NT seq 1446 nt NT seq  +upstreamnt  +downstreamnt
atgagtggtcagaccccacccacactccagaagcgagcaaggcagacacagctgagagat
gaggctttggccatatcccctctggagagcgtgccagctgtgtacgtcccatggctgttc
caagaggcctttgctggcagacacaactcgctcataaagacaatggtggcagcctggcct
ttccaatatctccctgtggggccattgataaatatgcataacctggaaaccttgcaagct
ctgctagatggtgtagacaggagactgacaagaaaatttccccccgggaggccaaaactt
caggttctcgacatgagaaatgtgcaccatggcttctggaacatagggagcgatgcaaat
gacagtgactctgatgcagagaccttggatgaaaagcaagtagtgaaggcccttcccaga
tatgcactgaggcagcgtctgaagatcatagttgatctgtcaatcagttctcagctcaat
gaagaaaaagcatatttcttgaattgggccaagcagagaaaggggtccataaatttctgc
tgtacaaagatgaagatctgggatgcaccagacaaagttatcagagaaatcatgaatgtt
tttcatccagagcacattacagaattagaactgtataccgactggactctgttgcggctg
gcacattttgctccctactttgggcagatgaaaaatcttgaaaaagtcttcctggcacca
ctccacaagaatacctcccctattatgaatataacaggggcctcaaaagtcaagtgtatc
aaaaagattatttctcagttttccaaattcaactgtctccaacatgtcttcatgaaacgt
gtccattttctcagagaccacctgcatcagatcctagggtgcctgaggacgcccttgcag
accctctccatcactcactgcctaatttcacagacagacttggattccttttcctgctgt
cacaacctttttaagttaaaaaatctggaaatcagaggagtgacattatttgctctcgat
cttatgcctctgagaggtctcctaggaaaactggcaggtactcttaagtctctggatttt
cagtggtgtagcatgaaggactcccagctcattgtcctcttacccgccctcagtcaatgc
tctcagctcaaccagatcaacttctacagcaatgacttctccatggccatcctgaaggac
cttttgcagcacacagccacctggagcaagatgaatgtggaacaataccctgtccctctg
gagtgctatgatgcattgggtcatgtctccagagaaagatttgtggaactttgtcaggag
ctcatggataccctcagggccaaaagagagcctaagagcatatcttttgcaacaaatgtc
tgccaaaattgtggcaagacctgtgtctatggccagggggcaaggctttgttcctgtttg
cagtaa

DBGET integrated database retrieval system