KEGG   Mus musculus (mouse): 100043627
Entry
100043627         CDS       T01002                                 

Gene name
Gm4559
Definition
(RefSeq) predicted gene 4559
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Keratin_B2 Keratin_B2_2
Other DBs
NCBI-GeneID: 100043627
NCBI-ProteinID: NP_001186238
MGI: 3782743
Ensembl: ENSMUSG00000056885
UniProt: A4IF42
Position
7 F5; 7
AA seq 199 aa
MTCCGCSGGCGSSCGGCGSSCCKPVCCCKPVCCCVPVCSCSSCGGCGSSCGGCGSCGSSC
GGCGSSCCKPVCCCVPVCSCSSCGGCKPCCCQSSCCKPCCSSGCGSSCCQSSCCKPCCCQ
SSCCKPCCSSGCGSSCCQSSCCKPCCCQSSCCKPCCCQSSCCKPCCCQSSCCKPCCCQSS
CCRPCCSSACGSSCCQDSC
NT seq 600 nt   +upstreamnt  +downstreamnt
atgacctgctgtggctgttcaggaggctgtggctccagctgtgggggctgtggctccagc
tgttgcaaacctgtgtgctgctgtaagcctgtgtgctgttgtgttcctgtctgttcctgc
tccagctgtggaggctgtggctccagctgtggtggatgtggcagctgtggctccagctgt
gggggctgtggctccagctgttgcaagcctgtgtgctgctgtgtgcctgtctgttcctgc
tccagctgtggaggctgcaagccctgctgctgccagtccagctgctgcaaaccctgctgc
tcttcaggctgtgggtcttcctgctgtcagtccagctgctgcaagccctgctgctgccag
tccagctgctgcaaaccctgctgctcttcaggctgtgggtcttcctgctgtcaatctagc
tgctgcaagccctgctgctgccagtccagctgttgcaagccctgctgttgtcagtccagc
tgctgcaagccctgctgctgtcagtccagctgctgcaagccctgctgctgtcagtccagc
tgctgcaggccctgctgttcatcagcctgcgggtcttcctgctgtcaggacagctgctga

DBGET integrated database retrieval system