KEGG   Mus musculus (mouse): 105243089
Entry
105243089         CDS       T01002                                 

Symbol
Gm39115
Name
(RefSeq) predicted gene, 39115
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Keratin_B2_2
Other DBs
NCBI-GeneID: 105243089
NCBI-ProteinID: NP_001334485
MGI: 5622000
Ensembl: ENSMUSG00000110091
Vega: OTTMUSG00000060160
UniProt: A0A1B0GSH7
Position
7 F5; 7
AA seq 232 aa
MTCCGCSGGCGSSCGGCGCSCGGCGSSCCKPVCCCKPVCCCVPACSCSSCGGCKGGCGSC
GGCKGGCGSCGGCKGGCGSCGGCKGGCGSCGGCKGGCGSCGGCKGGCSSCGGCKSSCCQS
SCCKPCCCQSSCCKPCCCESCCCKPCCCQSSCCKPCCCQSSCCKPCCCQSCCCKPCCCQS
CCCKPCCCESCCCKPCCCQSSCCKPCCCQSSCCKPCCCQSSCCAPVCCQCKI
NT seq 699 nt   +upstreamnt  +downstreamnt
atgacctgctgtggctgttcaggaggctgtggctccagctgtgggggctgtggctgcagc
tgtgggggctgtggctccagctgttgtaagcctgtgtgctgctgcaagcctgtgtgctgc
tgtgtgccagcctgttcctgctccagctgtgggggctgcaagggaggctgtggctcctgt
gggggctgcaagggaggctgtggctcctgtgggggatgcaaggggggctgtggttcctgt
gggggctgcaagggaggctgtggctcctgtgggggctgcaagggaggctgtggctcctgt
gggggctgcaagggaggctgtagctcctgtgggggctgcaaatctagctgctgccaatcc
agctgttgcaagccctgctgttgccaatccagctgctgcaagccctgctgctgcgaatcc
tgctgctgcaagccctgctgctgccagtccagctgctgcaagccctgctgctgccagtcc
agctgctgcaagccctgctgctgccagtcctgctgctgcaagccctgctgctgccaatcc
tgctgctgcaagccctgctgctgtgaatcctgctgctgcaagccctgctgctgccagtcc
agctgctgcaagccctgctgctgccagtccagctgctgcaagccctgctgctgccagtcc
agctgctgtgctcctgtgtgctgccagtgcaagatctga

DBGET integrated database retrieval system