KEGG   Mus musculus (mouse): 105243090
Entry
105243090         CDS       T01002                                 

Gene name
Gm7579, EG665305
Definition
(RefSeq) predicted gene 7579
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Keratin_B2_2
Other DBs
NCBI-GeneID: 105243090
NCBI-ProteinID: NP_001334484
MGI: 3647476
Ensembl: ENSMUSG00000073786
Vega: OTTMUSG00000048009
UniProt: A0A1B0GRJ4
Position
7; 7 F5
AA seq 243 aa
MTCCGCSGGCGSSCGGCGCSGGCGSSCGGCGSSCCCKPVCCCKPVCCCVPACSCSSCGGC
KGGCGSCGGCKGSCGSCGGCKGSCGSCGGCKGGCGSCGGCKSSCCQSSCCKPCCCQSSCC
KPCCSSGCGSSCCQSSCCKPCCCQSSCCKPCCSSGCGSSCCQSSCCKPCCCQSSCCKPCC
SSGCGSSCCQSSCCKPCCCQSSCCKPCCCQSSCCKPCCCQSSCCKPCCCQSSCCAPVCCQ
CKI
NT seq 732 nt   +upstreamnt  +downstreamnt
atgacctgctgtggctgttcaggaggctgtggctccagctgtgggggctgtggctgttca
ggaggctgtggctccagctgtgggggctgtggctccagctgctgttgcaagcctgtgtgt
tgctgcaagcctgtgtgctgctgtgtgccagcctgttcctgctccagctgtgggggctgc
aagggaggctgtggctcctgtgggggctgcaagggaagctgtggctcctgtgggggctgc
aagggaagctgtggctcctgtgggggatgcaagggaggctgtggctcctgtgggggttgt
aaatccagctgttgtcagtccagctgctgcaagccctgctgctgtcagtccagctgttgc
aaaccctgctgctcttcaggttgtgggtcttcttgttgccagtccagctgttgtaagccc
tgttgttgtcagtccagctgctgcaaaccctgttgctcttcaggctgtgggtcttcttgt
tgtcagtccagctgctgtaagccatgctgctgtcagtccagctgttgcaagccttgctgc
tcttcgggttgtgggtcttcttgttgccagtccagctgttgcaagccctgctgctgccag
tccagctgctgtaagccctgctgctgccagtccagctgctgcaagccctgctgctgccag
tccagctgctgtaagccctgctgctgccagtccagctgctgtgctcctgtgtgctgccag
tgcaagatctga

DBGET integrated database retrieval system