KEGG   Mus musculus (mouse): 140476Help
Entry
140476            CDS       T01002                                 

Gene name
Strc, DFNB16
Definition
(RefSeq) stereocilin
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 140476
NCBI-ProteinID: NP_536707
MGI: 2153816
Ensembl: ENSMUSG00000033498
Vega: OTTMUSG00000015264
UniProt: Q8VIM6
Position
2; 2 E5
AA seq 1809 aa AA seqDB search
MALSLQPQLLLLLSLLPQEVTSAPTGPQSLDAGLSLLKSFVATLDQAPQRSLSQSRFSAF
LANISSSFQLGRMGEGPVGEPPPLQPPALRLHDFLVTLRGSPDWEPMLGLLGDVLALLGQ
EQTPRDFLVHQAGVLGGLVEALLGALVPGGPPAPTRPPCTRDGPSDCVLAADWLPSLMLL
LEGTRWQALVQLQPSVDPTNATGLDGREPAPHFLQGLLGLLTPAGELGSEEALWGGLLRT
VGAPLYAAFQEGLLRVTHSLQDEVFSIMGQPEPDASGQCQGGNLQQLLLWGMRNNLSWDA
RALGFLSGSPPPPPALLHCLSRGVPLPRASQPAAHISPRQRRAISVEALCENHSGPEPPY
SISNFSIYLLCQHIKPATPRPPPTTPRPPPTTPQPPPTTTQPIPDTTQPPPVTPRPPPTT
PQPPPSTAVICQTAVWYAVSWAPGARGWLQACHDQFPDQFLDMICGNLSFSALSGPSRPL
VKQLCAGLLPPPTSCPPGLIPVPLTPEIFWGCFLENETLWAERLCVEDSLQAVPPRNQAW
VQHVCRGPTLDATDFPPCRVGPCGERCPDGGSFLLMVCANDTLYEALVPFWAWLAGQCRI
SRGGNDTCFLEGMLGPLLPSLPPLGPSPLCLAPGPFLLGMLSQLPRCQSSVPALAHPTRL
HYLLRLLTFLLGPGTGGAETQGMLGQALLLSSLPDNCSFWDAFRPEGRRSVLRTVGEYLQ
REEPTPPGLDSSLSLGSGMSKMELLSCFSPVLWDLLQREKSVWALRTLVKAYLRMPPEDL
QQLVLSAEMEAAQGFLTLMLRSWAKLKVQPSEEQAMGRLTALLLQRYPRLTSQLFIDMSP
LIPFLAVPDLMRFPPSLLANDSVLAAIRDHSSGMKPEQKEALAKRLLAPELFGEVPDWPQ
ELLWAALPLLPHLPLESFLQLSPHQIQALEDSWPVADLGPGHARHVLRSLVNQSMEDGEE
QVLRLGSLACFLSPEELQSLVPLSDPMGPVEQGLLECAANGTLSPEGRVAYELLGVLRSS
GGTVLSPRELRVWAPLFPQLGLRFLQELSETQLRAMLPALQGASVTPAQAVLLFGRLLPK
HDLSLEELCSLHPLLPGLSPQTLQAIPKRVLVGACSCLGPELSRLSACQIAALLQTFRVK
DGVKNMGAAGAGSAVCIPGQPTTWPDCLLPLLPLKLLQLDAAALLANRRLYRQLPWSEQQ
AQFLWKKMQVPTNLSLRNLQALGNLAGGMTCEFLQQISSMVDFLDVVHMLYQLPTGVRES
LRACIWTELQRRMTMPEPELTTLGPELSELDTKLLLDLPIQLMDRLSNDSIMLVVEMVQG
APEQLLALTPLHQTALAERALKNLAPKETPISKEVLETLGPLVGFLGIESTRRIPLPILL
SHLSQLQGFCLGETFATELGWLLLQEPVLGKPELWSQDEIEQAGRLVFTLSAEAISSIPR
EALGPETLERLLGKHQSWEQSRVGHLCGESQLAHKKAALVAGIVHPAAEGLQEPVPNCAD
IRGTFPAAWSATQISEMELSDFEDCLSLFAGDPGLGPEELRAAMGKAKQLWGPPRGFRPE
QILQLGRLLIGLGERELQELTLVDWGVLSSLGQIDGWSSMQLRAVVSSFLRQSGRHVSHL
DFIYLTALGYTVCGLRPEELQHISSWEFSQAALFLGSLHLPCSEEQLEVLAYLLVLPGGF
GPVSNWGPEIFTEIGTIAAGIPDLALSALLRGQIQGLTPLAISVIPAPKFAVVFNPIQLS
SLTRGQAVAVTPEQLAYLSPEQRRAVAWAQHEGKEIPEQLGRNSAWGLYDWFQASWALAL
PVSIFGHLL
NT seq 5430 nt NT seq  +upstreamnt  +downstreamnt
atggctctgagcctccagccccagctgctccttctcctgtcgctcctgccgcaggaagtg
acttcagcccctactgggcctcagtctttggatgctggtctctcccttctgaagtcattc
gtagccactctggaccaagctcctcagcgttccctcagccagtcacggttctctgcgttc
ctggccaacatttcttcatccttccagcttgggaggatgggggagggaccggtgggagag
cccccacctctccagccccctgcacttcgacttcatgatttcctcgtgacactgagaggt
agcccagactgggagccaatgctagggcttctgggagatgtgctggcactcctgggacag
gaacagactccccgggactttttggtgcaccaggcaggtgtactgggtggacttgtagag
gcattgttgggagcgttagttcctggaggcccccctgcccccactcgacccccatgcacc
cgtgatggcccttctgactgtgtcctggctgctgattggttgccttctctgatgttgtta
ttagagggtacacgctggcaggccctggtgcagttgcagcccagtgtggacccaaccaat
gccacaggtcttgatggtagagagccagctcctcactttttacagggtctgctgggcttg
cttaccccagcaggagagttgggctctgaggaggctctttggggtggtctgctgcgcaca
gtgggggcccccctctatgctgccttccaggaggggctactgcgagtcactcattctctg
caagatgaggtcttttctattatgggacagccagagcctgatgccagtgggcagtgccag
ggaggcaaccttcaacagctgcttttatggggcatgcggaacaacctttcttgggacgcc
cgagcactgggttttctatctggatcaccacctccaccccctgctctcctgcactgcctg
agcagaggtgtgcctctgcccagggcttcccagcctgcggctcacatcagccctcgacag
cggcgagccatctctgtggaggccctctgcgagaaccactcaggcccagagccaccctac
agcatctccaacttctccatctacttgctctgccagcacatcaagcctgccaccccgcgg
ccccctcctaccaccccacggcctcctcctaccaccccacagccccctcctaccactaca
cagcccattcctgacactacacagccccctcctgtcaccccaaggcctcctcctaccacc
ccacaaccccctcctagcacagctgtcatctgccagacagctgtatggtacgcagtctcg
tgggcaccaggtgcccgaggttggctccaagcctgccatgatcagtttcctgatcaattt
ctggatatgatctgcggcaacctctcattttcagccctgtctggccccagtcgtcctttg
gtaaagcagctctgtgctggcttgctcccaccccccactagctgtccaccaggcctgatc
cctgtgcccctcaccccagaaatattctggggctgtttcctggagaatgagacactgtgg
gctgaacggttgtgtgtggaggacagtctgcaggctgtgcccccgaggaaccaggcttgg
gttcagcatgtgtgtcggggccccaccttggacgccactgattttccaccgtgccgcgtt
ggaccctgtggggaacgctgcccagatgggggcagcttcctgctcatggtctgtgccaat
gacactctgtatgaagccttggttcccttctgggcttggctagcaggccaatgcagaatt
agtcgtggaggaaatgatacttgctttctagaaggcatgctgggccccttgttgccctct
ctgccccctctgggaccatccccactctgtctggctcctggtccttttctgcttggcatg
ttatcccagttgccacgctgtcagtcctccgtgccagccctcgcccaccccacgcgccta
cattacctcctgcgcctactgaccttccttctgggtccagggactgggggtgccgagacg
caggggatgttaggtcaagccctgctgctctctagtctcccagacaactgttcattctgg
gatgccttccgcccagagggccggagaagtgtactgaggacagtcggagagtacttgcag
cgggaagagccaaccccaccaggcttagactcctccctcagcctcggctctggtatgagc
aagatggagcttctgtcctgcttcagtcctgtactgtgggatctactccagagagagaag
agcgtttgggccctgaggaccctggtgaaggcctacctgcgcatgcctccagaagacctt
cagcagcttgtgctttcagcagagatggaggctgcacagggcttcctgacgctcatgctt
cgttcctgggctaagctgaaggttcaaccatccgaggagcaggccatgggccgcctgaca
gccttgctgctccagcggtacccacgcctcacctcccaactctttatcgacatgtcaccg
ctcatccccttcctggctgtccctgacctcatgcgcttcccaccgtcccttttggccaac
gacagtgtcctggctgccatcagggatcacagctcaggaatgaagcctgaacagaaggag
gccctggcaaaacgactgctggcccctgagctgtttggagaagtgcctgattggccccag
gagctgctgtgggcagccctgcctctgcttccccatctgcctctggagagctttctccag
ctcagccctcaccagatccaggccctggaggatagctggccagtagcagatcttgggccg
ggacacgcccgacatgtgcttcgtagcctagtaaaccagagcatggaggatggggaggag
caggtgctcaggcttgggtccctcgcctgtttcctgagtcctgaggagctacagagtctg
gtgcccttgagtgatccaatggggcctgtagaacagggtctgctggaatgtgcggccaat
gggaccctcagcccagaaggacgggtggcatatgaacttctgggagtgttgcgttcatct
ggaggaactgtcttaagcccccgagagctgagggtctgggcacctctctttccccagctg
ggcctccgcttcctgcaggagctctcagagacccagcttagagccatgcttcctgcccta
cagggagccagtgtcacacctgcccaggctgttctgttgtttggaaggctccttcctaag
catgatctgtccctggaggaactctgctccctgcaccctctcctgccaggtctcagcccc
cagacactccaggccatccctaagagagttctggttggtgcttgttcctgcctgggccct
gaactgtcaaggctttcagcttgccagattgcagctctgctgcagacctttcgggtaaaa
gatggtgttaaaaatatgggtgcagcaggtgccggctcagccgtgtgcattcctgggcag
cccaccacttggccagactgcctgcttcccctgctcccattaaagctgctacagctggac
gctgcagctcttctggcaaaccgaagactctatcggcagctgccttggtctgagcaacag
gcacagtttctctggaagaaaatgcaagtgcctaccaacctgagcctgaggaatctgcag
gctctgggcaacttggcaggaggcatgacctgcgagtttctgcagcagatcagctcaatg
gttgactttcttgatgtggtacacatgctctaccagctgcccactggtgttcgagagagc
ctgcgggcctgtatctggacagagctacagcggaggatgacaatgccagagccagagctg
accaccctagggccagaactgagtgaacttgacacaaagctactcctggacttgccgatc
cagctgatggacagattgtccaatgattccattatgttggtggtggagatggtccaaggc
gctccagagcagctgctggcactgaccccactccaccagacagccttggcagagcgagca
cttaaaaacctggctccaaaggagaccccaatctccaaagaagtgctggagacactgggc
cccttggttggattcctgggaatagagagcacgcgacggatccctttacccattctactg
tctcatctcagtcagctgcagggcttctgcctaggagagacatttgccacagagctggga
tggctgctgttgcaggagcctgttcttggaaaaccagaattgtggagccaggatgaaata
gagcaagctggacgcctagtattcactctgtctgctgaggctatttcctcgatccccagg
gaggctttgggcccagagacactggagaggcttctgggaaagcatcaaagctgggagcag
agcagagtgggccatctgtgtggggagtcacagcttgcccacaagaaagcagctctggta
gctgggattgtgcatccagctgctgagggtctccaagagcctgtaccaaactgtgcagac
atacggggaaccttcccagcggcctggtctgcgacacaaatctcagagatggaactctca
gactttgaagactgcctgtcactatttgctggagatccaggacttggtcctgaggaacta
cgggcagccatgggcaaggccaagcagttgtggggtccccctcgaggattccgtcctgag
cagatcttgcagctgggccgtctcctgataggtctaggagaacgggaactgcaggagctt
accttggtggactggggtgtgctgagcagcctggggcaaatagatggctggagttccatg
cagctccgagccgtggtctccagtttcctaaggcagagtggtcggcatgtgagccacctg
gacttcatttatctgacagcactgggttacacagtctgtggattgcgaccagaggagtta
cagcacatcagcagttgggagtttagccaagcagctctcttcctgggtagcttgcatctc
ccgtgctctgaggaacagctggaagttctggcctatctccttgtgttgcctggtggcttt
ggcccagtcagtaactgggggcctgagatcttcactgaaattggcacaatagcagctggc
atcccagacctggctctttcagcattactgcggggacagatccaaggcctgactcctctt
gccatttctgtcattcctgctcccaagtttgcagtggtcttcaaccccatccagttatct
agtctcaccaggggtcaggccgtagctgttactcctgaacagctggcctatctgagtcct
gagcagcggcgagcagttgcatgggcccaacacgaagggaaggagatcccagagcagctg
ggtcgaaactcagcctggggtctctacgactggttccaagcctcctgggccctggcattg
cccgtcagcatttttggccacctattatga

DBGET integrated database retrieval system