KEGG   Mus musculus (mouse): 15937Help
Entry
15937             CDS       T01002                                 

Gene name
Ier3, AI663993, IEX-1, cI-3, gly96
Definition
(RefSeq) immediate early response 3
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 15937
NCBI-ProteinID: NP_598423
MGI: 104814
Ensembl: ENSMUSG00000003541
Vega: OTTMUSG00000037405
UniProt: Q91VZ5
Position
17; 17 B1
AA seq 160 aa AA seqDB search
MCHSRNHLHTMTGLRAPSPAPSTGPELRRGSGPEIFTFDPLPERAVVSTARLNTSRGHRK
RSRRVLYPRVVRRQLPTEEPNIAKRVLFLLFAIIFCQILMAEEGVSQPLAPEDATSAVTP
EPISAPITAPPVLEPLNLTSESSDYALDLKAFLQQHPAAF
NT seq 483 nt NT seq  +upstreamnt  +downstreamnt
atgtgccactcgcgcaaccatctccacaccatgactggcctgagggccccttctccagct
ccctccaccggcccggaactccggcggggctctggtcccgaaattttcaccttcgaccct
ctcccggagcgggccgtggtgtccaccgcgcgtttgaacacttctcgcgggcaccgaaaa
cgcagccgaagggtgctctaccctcgagtggtccggcgccagctaccaaccgaggaaccc
aacattgccaagagggtcctctttctcctgttcgccatcatcttctgccagattttgatg
gctgaagagggtgtgtcgcagcccctggctccggaggatgctaccagcgccgtgacacct
gagcccatttctgcgcccattactgcgcccccggtcctcgagcctttgaacctgacctcg
gagtcctcggactatgcgctggatcttaaagcttttctccagcaacatccggcggccttc
taa

DBGET integrated database retrieval system