KEGG   Mus musculus (mouse): 170939Help
Entry
170939            CDS       T01002                                 

Gene name
Krtap19-9b, Krtap16-10b, Krtap16.10L
Definition
(RefSeq) keratin associated protein 19-9B
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Motif
Pfam: KRTAP
Motif
Other DBs
NCBI-GeneID: 170939
NCBI-ProteinID: NP_579937
MGI: 2181750
Ensembl: ENSMUSG00000057174
UniProt: Q99NG9
Position
16; 16 C3.3
AA seq 58 aa AA seqDB search
MSYYYGNYYGGLGYGLGGFGGFGGLGYGYGSSYGLGGYGGYGYFSPSFYGGYLSSGFY
NT seq 177 nt NT seq  +upstreamnt  +downstreamnt
atgagctactactacggcaactactatggtggccttggctatggccttggtggctttggt
ggctttggtggcctgggatatggctatggttccagctatggccttgggggctatggtggc
tatggctacttcagtccctctttctatggaggatatttgtcttctgggttttactga

DBGET integrated database retrieval system