KEGG   Mus musculus (mouse): 194225Help
Entry
194225            CDS       T01002                                 

Gene name
Gm13103, E330017N17
Definition
(RefSeq) predicted gene 13103
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 194225
NCBI-ProteinID: NP_808239
MGI: 3650203
Ensembl: ENSMUSG00000029451
Vega: OTTMUSG00000010433
UniProt: Q4VAD2
Position
4 E1; 4
AA seq 491 aa AA seqDB search
MVICQQCPDQDDSSEEETIDVYSPPTLLKLAIHRLLREEALAISSLKDLPNMLFPVLFEE
AFIFGYTKILKAMIPEWPFSYLSIAVLIDNCNLESLKAVLEGLDILLAQKLHSSRCKLKE
ISWRDKNHGLDGIRPGSHEVEGLSEFMEQKHPNCVEKKKLKVTTELSVMNGRLNESDTYL
LEWTQQRKDSIHLFCRKLVIQSLTKATVIENFKIVNADCIPELELCSLCLQDLAFLNPYL
RQMDNLLELTLDHITDSLSIGDSEMLEERMITLVSQLPTFPCLQKLCINDVYFIYGNLKE
FLGCLKKPLVSFCISNCELSQSDLDYLPYCLNIFELKCLYIINIHLQYLCLEPLGFLLES
VRHTLGCLALKSCNMGEPHFKSLLPALSQCSHLTDVNFQENELSLLSLKQLLQHTSKVTQ
LSYEMYPGPLECYDDRGVILSHRIEQFCPEVLDIPRAKRQPKDINFVTTQCSKCGIYYVY
DLETQRCRFLK
NT seq 1476 nt NT seq  +upstreamnt  +downstreamnt
atggtgatctgtcagcagtgtccagatcaagatgactcttcagaagaagaaacaattgat
gtctactccccacccaccctgctgaagctggcaatacacaggctactgagagaggaggct
ttagccatttcttctctcaaggacctgcccaatatgctgttcccagtgttgtttgaggag
gccttcatttttggttatacaaagatcttgaaggccatgatacctgagtggcccttttca
tacctttctatagcagtgctgatagacaactgcaacctggagagtttgaaggctgttctt
gagggactagatatacttcttgcacaaaagcttcactccagtaggtgcaaactcaaagag
atcagttggagggataaaaaccatggtttggatggaatacggcctggatcccatgaagtt
gaaggtttatcagagttcatggaacagaaacatcctaattgtgtggagaagaaaaaattg
aaggtaacaactgaactctctgtcatgaatggcagacttaatgaatctgacacatacttg
ttggagtggacccagcaaagaaaagattccattcatctattctgtaggaagctggtaatt
caaagcttaaccaaagccacagtgatagaaaacttcaaaattgtaaatgcagattgtata
ccagagctggagctatgttctctttgcctacaagatctggcgtttcttaatccctacctg
agacagatggacaatcttcttgaactcacacttgatcacatcacagattccctcagtatt
ggtgattctgaaatgcttgaggaaagaatgatcacattggtttctcagcttcccacattt
ccctgtctccagaaactctgtataaatgatgtctactttatatacggcaatctgaaagaa
ttcctcgggtgcctgaagaagccattggtatcattttgcatcagtaactgtgaactctca
caatcagacttggattacctgccctattgcctgaatatttttgagctaaaatgtttgtac
attattaatatacatttacaatatttatgccttgagcctcttgggtttctccttgagagt
gttagacataccctgggttgcttggcattaaagtcatgtaatatgggggaacctcatttc
aaatccctgctgcctgccctaagtcaatgttcccacctcacagatgtcaatttccaggaa
aatgaactctctctgctgtccctgaaacaacttctacagcacacatccaaggtgacccag
ctgagctatgagatgtatcccggccctcttgagtgctatgatgacaggggtgtaatacta
tcacacagaatagaacaattttgtcctgaagtcctggatatacccagggccaaacgacag
cccaaggatatcaactttgttacaacccaatgttctaagtgtggtatatattatgtttat
gatctggagacccaacgttgtcgttttttaaaatga

DBGET integrated database retrieval system