KEGG   Mus musculus (mouse): 19782
Entry
19782             ncRNA     T01002                                 

Gene name
Rmrp, 1110032O22Rik, Rmrpr
Definition
(RefSeq) RNA component of mitochondrial RNAase P
  KO
K14576  small nucleolar RNA MRP
Organism
mmu  Mus musculus (mouse)
Pathway
mmu03008  Ribosome biogenesis in eukaryotes
Brite
KEGG Orthology (KO) [BR:mmu00001]
 09120 Genetic Information Processing
  09122 Translation
   03008 Ribosome biogenesis in eukaryotes
    19782 (Rmrp)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:mmu03009]
    19782 (Rmrp)
  09184 RNA family
   03100 Non-coding RNAs [BR:mmu03100]
    19782 (Rmrp)
Ribosome biogenesis [BR:mmu03009]
 Related small nucleolar RNAs
  Other snoRNA
   19782 (Rmrp)
Non-coding RNAs [BR:mmu03100]
 Small non-coding RNA
  Small nucleolar RNA
   19782 (Rmrp)
SSDB
Other DBs
NCBI-GeneID: 19782
MGI: 97937
Ensembl: ENSMUSG00000088088
Position
4; 4 A5
NT seq 275 nt   +upstreamnt  +downstreamnt
agctcgctctgaaggcctgtttcctaggctacatacgagggacatgttccttatcctttc
gcctaggggaaagtccccggaccacgggcagagagtgccgcgtgcacacgcgcgtagact
tcccccgcaagtcactgttagcccgccaagaagcgacccctccggggcgagctgagcggc
gtgcagcggggcgtcatccgtcagctcacatagtgacgcaggcagtgcgacctggctcgc
accaaccacacggggctcattctcagcgcggctac

DBGET integrated database retrieval system