KEGG   Mus musculus (mouse): 234776
Entry
234776            CDS       T01002                                 

Gene name
Atmin, As, Asciz, gpg, gpg6, mKIAA0431
Definition
(RefSeq) ATM interactor
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 234776
NCBI-ProteinID: NP_808368
MGI: 2682328
Ensembl: ENSMUSG00000047388
Vega: OTTMUSG00000037784
UniProt: Q6P9S1
Position
8; 8 E1
AA seq 818 aa
MAATEAAAADSAGPAPGVPATPASTRGAAAASSPWRPPESRLQGSRPRPARARAAAPVPP
ARELIQPTVSELSRAVRTNILCTVRGCGKILPNSPALNMHLVKSHRLQDGIVNPTIRKDL
TTAPKFYCCPIKGCPRGPDRPFSQFSLVKQHFMKMHAEKKHKCSKCSNSYGTEWDLKRHE
EDCGKTFQCTCGCPYASRTALQSHIYRTGHEIPAEHRDPPSKKRKMESYLQNQKLSSKTT
EPLSDQAAPRQDAAEPDAPEVKPAASLEDSCSAHTKKQSVATPPRCPQKLLLPKPKVALV
KLPVMQFSPVPVFVPTAESSAQPVVLGVDHSSAAGTVHLVPLSVGALILSLDSEACSLKE
SLPLSKIISPVVEPMNTGVQVNLGKSLCSPLQEVGSVCQRTSISSSNVQTDLTYASANLI
PSAQWLGPDSSVSSCSQTDLSFDSQVSLPVSVHTQTLVPSSKVTSSIAAQTDAFIDACFQ
PGGVSRETQTSRMQNRTNDSVPVGHTGLCGDIFESVHASYSVPTDTIMSSSLVAETGTHG
LPPQSDPKILGQVMEKSAPVLNFSTQNGLLPAHTMTDNQTQTIDLLSDLENILSSNLPGQ
TLDNRSLLSDTNPGPDAQLPAGSAQNSGIDFDIEEFLSASNIQTQTEESELSSMSTEPVL
ESLDIETQTDVLLSDPSTQPYGFRAGSGFLGLEMFDTQTQTDLNFFLDSSPHLPLGSILK
HSSFSMSTDSSDTETQTEGACPARHLPALESKVQLSSTETQTMSSGFEPLGNLFLTSNET
QTAMDDFLLADLAWNTMESQFSSVETQTCAELHAVSSF
NT seq 2457 nt   +upstreamnt  +downstreamnt
atggcggccacggaggcggcggcggccgattctgcgggtccggccccgggtgtcccggcc
acgccggcgagcacgcggggagccgccgccgcctctagcccgtggaggccgcccgagtcg
cgactgcaaggcagccggccgagaccggccagggctcgggccgcggccccggtgccaccg
gcccgggagctgatccagccgactgtgagcgagctgtcccgggctgtgcgcaccaatatt
ctgtgcaccgtgcgcggctgcggcaagatcctgcccaacagccctgcgctcaacatgcac
ctcgtcaagagccaccgactgcaggatggcatagtaaacccgacaataaggaaagacttg
acaactgcaccgaaattctactgttgtccaatcaaaggatgtcctcgaggccccgaccga
ccgttttctcagttttctctggttaaacagcactttatgaaaatgcatgcagagaagaag
cacaaatgcagtaagtgcagtaattcctacggcaccgagtgggacctgaaaagacacgag
gaggattgtggcaagaccttccagtgtacgtgcggctgtccctacgccagcagaaccgca
ctgcagtctcacatctaccgaactggccacgagatccctgcagagcacagagacccacct
agtaaaaaaaggaaaatggaaagctacctgcaaaaccaaaagttgtccagtaaaaccact
gaaccactgagcgaccaagcagccccgcgccaagatgctgctgaaccggatgctccggag
gtcaagcctgcagcatccctcgaagactcctgtagcgcccacaccaaaaagcagagcgtc
gcgacgcctccccggtgtccccagaagttgctgttaccaaagcccaaggtggctctggtt
aaactcccagtcatgcagttttcccccgtgcctgtctttgtgcctacagcggagtcctcg
gcccagcctgtggtgttaggtgtggatcacagttctgcagccggtactgtgcacttagta
cctctgtcggtaggagccctgatcctcagcctggactcagaggcctgctctctgaaggag
agcctacctctctcaaaaattatcagtcctgttgttgagccaatgaatacaggtgttcaa
gtgaacttgggtaaaagcctgtgtagtcctttacaagaggtagggagtgtgtgtcagagg
accagcatttcctcaagcaacgtgcagacagatctgacctatgcctcagccaacttgata
ccctctgctcagtggctcggccctgattcctctgtgtcatcgtgttctcagactgacctg
tcgtttgattctcaagtgtcccttcctgttagtgtccacacccagacgttggtgcccagc
tctaaggtcacttcatccatagctgctcagacagatgcatttatagacgcctgtttccag
cctggtggggtctccagggaaacccagaccagcaggatgcagaaccgcacaaacgactca
gtgccagtgggccacactggcttgtgtggggacatttttgaaagcgtgcatgcgtcatac
agtgtgcctactgacaccatcatgagtagcagcttagttgcagagacagggactcatggt
ctgccacctcagagtgaccctaagatcttaggccaagtcatggaaaagtctgcacccgtg
ttaaacttcagcacccagaacggcttgcttcctgcacacaccatgacagataatcagacc
caaaccatagatctgctgagcgacttggaaaacatcttgtcaagtaacctgccaggtcaa
acactggataaccggagtctcttgtccgacaccaaccccggacctgacgcccagctccca
gctggctcagcgcagaattctgggattgattttgatattgaagagttcctctcagcctcc
aatatccagactcagactgaggagagtgagctcagctccatgagcactgagccggtcctg
gagtccctggacatcgagacgcagaccgacgtcctcctctcagatccctccacacagccc
tatggcttcagagcggggtcaggcttcctgggccttgagatgttcgacacacagacacaa
acagacttaaacttcttcttagacagtagtcctcacctgcccctgggcagcatcctgaaa
cactccagcttctccatgagtaccgactcctctgacacagagacccaaactgaaggagcc
tgccctgctcggcacctgcctgctctggagagcaaggtccagttgagcagcacagaaaca
caaaccatgagttctggcttcgagcccctggggaacttgttcctcaccagcaacgaaact
cagacagcaatggatgacttccttctagccgatctggcctggaatacgatggagtcccag
ttcagctccgtggaaacccagacatgcgcagagctgcacgctgtctccagcttctga

DBGET integrated database retrieval system