KEGG   Mus musculus (mouse): 320549
Entry
320549            CDS       T01002                                 

Gene name
Pramel48, D5Ertd577, D5Ertd577e, E330023J07Rik
Definition
(RefSeq) PRAME like 48
Organism
mmu  Mus musculus (mouse)
Other DBs
NCBI-GeneID: 320549
NCBI-ProteinID: NP_001346946
MGI: 1261918
Ensembl: ENSMUSG00000070677
Vega: OTTMUSG00000055673
Position
5 E3; 5 47.29 cM
AA seq 481 aa
MSGQTPPTLQKLARQTLLRDEALAISSLEELPAVVFPPLFQEAFAGRLNKLIKAMVAAWP
FHDLPVGPLINMHNLETLQALLDGVDMRLTRKFHPWRPKLQVLDMRNVDHVFWNIWSDAN
DSDSDAETLDEKQVVKAPRRYALRQRLKIIVDLSISSQLNEQKAYFLNWAKQRKGSINFC
CTKMKIWDAPDEVIREIMNVFHPEHITELELYTDWTLLRLAHFAPYIGQMKNLERVFLAP
LHKNTSPIMNLTRDSKVKCIKKIISQFSKFNCLQHVFMKRVHFLRDHLHQILGCLRTPLQ
TLSITHCLISQTDLDSFSCCHNLFKLKNLEIRGVTLFALDLMPLRGLLGKLAGTLESLDF
QWCSMKDSQLIVLLPALSQCSQLNQINFYSNDFSMAILKDLLQHTANWSKMNVEQYPVPL
ECYDALGHVSRERFVELCQELMDTLRAKREPKSISFATNVCQNCGKTCVYGQGARLCSCL
Q
NT seq 1446 nt   +upstreamnt  +downstreamnt
atgagtggtcagaccccacccacactccagaagctagcaaggcagacactgctgagagat
gaggctttggccatatcctctctggaggagctgccagctgtggtcttcccaccactgttc
caagaggcctttgctggcagactcaacaagctcataaaggcaatggtggcagcctggcct
ttccacgatctccctgtggggccattgataaatatgcataacctggaaaccttgcaagct
ctgctagatggagtagacatgagactaacaagaaaatttcacccctggaggccaaaactt
caggttctcgacatgagaaacgtggaccatgtcttctggaacatatggagcgatgcaaat
gacagtgactctgatgcagagaccttggatgaaaagcaagtagtgaaggcccctcgcaga
tatgcactgaggcagcgtctgaagatcatagttgatctgtcaatcagttctcagctcaat
gaacaaaaagcatatttcttgaattgggccaagcagagaaaggggtccataaatttctgc
tgtacaaagatgaagatctgggatgcaccagacgaagttatcagagaaatcatgaatgtt
ttccatccagagcacattacagaattagaactgtataccgactggactctgttgcggctg
gcacattttgctccctacattgggcagatgaaaaatcttgaaagagtcttcctggcacca
ctccacaagaatacctcccctattatgaatttgacaagggactcaaaagtcaagtgtatt
aaaaaaattatttctcagttttccaaattcaactgtctccaacatgtcttcatgaaacgt
gtccattttctcagagaccacctgcatcagatactagggtgcctgaggacgcccttgcag
accctctccatcactcactgcctaatttcacagacagacttggattccttttcctgctgt
cacaacctttttaagttaaaaaatctggaaatcagaggagtgacattatttgctctcgat
cttatgcctctgagaggtctcctaggaaaactggcaggtactcttgagtctctggatttt
cagtggtgtagcatgaaggactcccagctcattgtcctcttacctgccctcagtcaatgc
tctcagctcaaccagatcaacttctacagcaatgacttctccatggccatcctgaaggac
cttttgcagcacacagccaactggagcaagatgaatgtggaacaataccctgtccctctg
gagtgctatgatgcattgggtcatgtctccagagaaagatttgtggaactttgtcaggag
ctcatggataccctcagggccaaaagagagcctaagagcatatcttttgcaacaaatgtc
tgccaaaattgtggcaagacctgtgtctatggccagggggcaagactttgttcctgtttg
cagtaa

DBGET integrated database retrieval system