KEGG   Mus musculus (mouse): 320700Help
Entry
320700            CDS       T01002                                 

Gene name
A930033H14Rik
Definition
(RefSeq) RIKEN cDNA A930033H14 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 320700
NCBI-ProteinID: NP_001318122
MGI: 2444562
Ensembl: ENSMUSG00000090622
Vega: OTTMUSG00000035398
UniProt: G5E8X6
Position
10; 10 B5.3
AA seq 103 aa AA seqDB search
MKPGPGVSELWDARWRRCCGCTHTGGAWAPGPGSACVPLPRGPGLKPSGDQSRAGCVRAV
PAPPPRSIPPTPEHPLALSPGLRKRNLGRENQFRGHCGLSSRL
NT seq 312 nt NT seq  +upstreamnt  +downstreamnt
atgaaaccagggcctggtgtgtctgagctgtgggacgcgaggtggcgaaggtgctgcggc
tgcacgcacaccggaggggcctgggctccagggccgggatcagcgtgcgtcccgctaccc
cggggacccggccttaagccaagcggagatcagagcagggcagggtgtgtgcgagctgtc
cccgcgccccctccccgcagcatcccacccactcccgaacatccgctggccctcagtcct
gggctcaggaaaagaaatcttggaagggaaaaccagtttcggggacactgtggactttca
agccgattgtga

DBGET integrated database retrieval system