KEGG   Mus musculus (mouse): 329436Help
Entry
329436            CDS       T01002                                 

Gene name
Gm14461, A830093M07
Definition
(RefSeq) predicted gene 14461
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 329436
NCBI-ProteinID: NP_808511
MGI: 3651589
UniProt: Q8BRI5
Position
2 C3; 2
AA seq 102 aa AA seqDB search
MTSWIVLLEMALCGLLYQCFPGMGAEQSQWYVSSCCPSLKDLIMREELKLDYFLFLECCM
FQALSLSLPETLSCYLQTTLCFWGHLKCCSFYKIFVLEVILS
NT seq 309 nt NT seq  +upstreamnt  +downstreamnt
atgacttcctggattgtgttgctggagatggctctctgtggactcctgtatcaatgtttc
cctggcatgggggcagagcagtctcagtggtatgtttctagctgctgtcccagcctaaag
gatttaattatgcgtgaagagttgaaactggattatttcttgtttcttgaatgttgtatg
ttccaggctttgagccttagcctacctgaaactctttcttgctatctacagacaacctta
tgtttctggggtcatctcaaatgctgttctttctataaaatatttgtcctagaagtgatc
cttagttga

DBGET integrated database retrieval system