KEGG   Mus musculus (mouse): 329659
Entry
329659            CDS       T01002                                 

Symbol
E130311K13Rik
Name
(RefSeq) RIKEN cDNA E130311K13 gene
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 329659
NCBI-ProteinID: NP_808524
MGI: 3607716
Ensembl: ENSMUSG00000048581
Vega: OTTMUSG00000034984
UniProt: Q8BN57
Position
3:complement(63822103..63836897)
AA seq 294 aa
MARPPASLGSQAPDRDRGEANVVTRVSQWADNHLRLVQNISTGMAIAGIMLLIRSVRLTS
KFTTSSDIPVEFIRKKVKLRGRLQRITECGLEIEHIPITLPFISSWKEEPRGVLLVKLAG
VELTESGKVWLQAELKPSQLLWFQLLGKEDSALFCYLLVNKGGYFNVNLNEEILRRGLGK
TVLVKGLNYDSKTHWKIHRNLLKAELTALKKGEGIWKEESEKESYFRKLKDSWRERWTKD
NDLKPAGADLGSTKDSYHDSRRRASGKGKDSVSNYSFFLKLREFVSRLHFWRKG
NT seq 885 nt   +upstreamnt  +downstreamnt
atggcgcggccgcccgcgagcctcgggtcgcaggcgccggaccgcgaccgaggggaggcc
aacgtggtgacacgggtgtcgcaatgggcagacaaccatctgcgccttgtccagaacatc
agcacgggaatggccatagctgggataatgttgctgataaggagcgtccggctgacctca
aaatttacaacctcttcagatattccagtagaatttataagaaagaaagttaaactacgt
ggccgattacagcggataactgagtgtggtctagaaattgaacatatacctattacttta
cctttcatatcttcatggaaagaagaaccacgtggagttttgctggttaaactggctgga
gtagaactcactgaaagtggtaaggtgtggctacaggcagagctgaagccttcccagctg
ctctggttccagctcctcggaaaggaggactcagcactcttttgctacctactagtgaac
aagggcggatattttaacgtgaatctgaatgaggagattttgagaagaggcttgggcaaa
accgtccttgttaaagggctaaattatgactcaaaaacccactggaaaattcacagaaac
ttacttaaagctgaattgacggccttaaagaaaggagaaggaatatggaaggaagagtct
gaaaaagaaagctattttagaaaattgaaagactcctggagagagagatggacaaaggac
aatgatttaaaaccagctggagcagacctcggctccaccaaagacagttatcacgacagc
cggcgcagggcgtccgggaaggggaaggacagcgtgagcaactactctttctttctgaaa
ctcagagaatttgtgagccgcttacacttttggaggaaaggatga

DBGET integrated database retrieval system