KEGG   Mus musculus (mouse): 381677
Entry
381677            CDS       T01002                                 

Gene name
Vgf, Gm1052
Definition
(RefSeq) VGF nerve growth factor inducible
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 381677
NCBI-ProteinID: NP_001034474
MGI: 1343180
Ensembl: ENSMUSG00000037428
Vega: OTTMUSG00000049328
UniProt: Q0VGU4
Position
5 G2; 5 76.13 cM
AA seq 617 aa
MKTFTLPASVLFCFLLLIQGLGAAPPGRPDVFPPPLSSEHNGQVAEDAVSRPKDDGVPEV
RAARNPEPQDQGELFQGVDPRALASVLLQALDRPASPPSVPGGSQQGTPEEAAEALLTES
VRSQTHSLPAPEIQAPAVAPPRPQTQDRDPEEDDRSEELEALASLLQELRDFSPSNAKRQ
QETAAAETETRTHTLTRVNLESPGPERVWRASWGEFQARVPERAPLPPPVPSQFQARMSE
SAPLPETHQFGEGVSSPKTHLGETLTPLSKAYQSLGGPFPKVRRLEGSFLGGSEAGERLL
QQGLAQVEAGRRQAEATRQAAAQEERLADLASDLLLQYLLQGGARQRDLGGRELQETQQE
RENEREEEAEQERRGGGEDDVGEEDEEAAEAEAEAEEAERARQNALLFAEEEDGEAGAED
KRSQEEAPGHRRKDAEGAEEGGEEDDDDEEMDPQTIDSLIELSTKLHLPADDVVSIIEEV
EEKRKRKKNAPPEPVPPPRAAPAPTHVRSPQPPPPAPARDELPDWNEVLPPWDREEDEVF
PPGPYHPFPNYIRPRTLQPPASSRRRHFHHALPPARHHPDLEAQARRAQEEADAEERRLQ
EQEELENYIEHVLLHRP
NT seq 1854 nt   +upstreamnt  +downstreamnt
atgaaaaccttcacgttgccggcatccgtcctcttctgcttccttctactgatccagggg
ttgggagcagcgccccccgggcgccccgatgtttttcctcctcccctcagctctgagcat
aatgggcaggtagctgaggacgcagtgtcccggccaaaggatgacggcgtaccagaggtc
cgagctgctcggaatcccgagcctcaggaccagggagagctcttccagggcgtggatccc
cgggcgctggcctcggtactgttgcaggcactggaccgtccggcctcgcccccgtcggtc
ccgggaggttcccagcagggaacacccgaagaagcagcagaagctctgctgaccgagtcc
gtgcgcagtcagacccatagcctcccggcaccagaaatccaagcgcccgctgtggccccc
cctcgccctcagactcaggaccgcgatcccgaggaggacgaccgctcagaagagctggag
gcgctagcatccttgctccaagaacttcgagatttcagtccgagcaatgctaagcgccaa
caagagacggcggcagcagagactgaaacccgcacgcacacgctgacccgagtcaatctg
gagagccccgggccagagcgcgtgtggcgcgcttcctggggagagttccaggcgcgcgtt
ccggagcgcgctcctcttccgcccccggtcccttcccaattccaggctcgaatgtccgaa
agcgctccccttcccgaaactcatcagttcggggaaggagtgtcctcccctaaaacacat
ttaggtgagactttgacacccttatccaaggcgtatcaaagtctaggtggccccttccct
aaggtgcgccggctcgagggctcattcctgggcggctccgaggcaggagagcgcctgctt
cagcaaggattagctcaggtagaggcagggaggagacaggcggaggccacccggcaggcc
gcggcgcaagaagagcggctggccgatctcgcctccgacctgctgctccagtatctgttg
cagggcggagcccggcagcgcgatctcgggggtcgcgagctgcaggagacgcagcaagag
cgggagaacgagagggaggaggaggcagagcaggagaggcgaggtggtggggaggacgat
gtgggggaagaggatgaggaggcggcggaggcggaggcggaggcagaggaggcggagagg
gcgcggcagaacgcactcctgttcgccgaggaggaggacggggaagccggagccgaggac
aaacgctcccaggaggaggcgccaggccatcggcggaaggatgctgagggggcagaggag
ggcggggaggaggatgacgacgacgaggagatggatccgcagacgatcgatagtctcatt
gaactgtccaccaaactccacctgccagcagacgatgtggtcagcatcatcgaagaggtg
gaggagaaacggaagcggaagaagaacgcccctcccgagccggtgccgcctcccagggct
gccccagccccgacccatgtccgctctccgcagcccccacctcccgccccagcccgggat
gagttgccggactggaacgaagtgctcccaccctgggatcgggaggaggatgaggtgttt
cccccggggccctatcaccccttcccaaactacattcggccgcggacactgcagccgccc
gcatcctcccgccgccgtcacttccatcacgcgttgccacctgcgcgccaccatccggat
ctggaggcccaggccaggcgcgcgcaggaggaagcggacgcggaggagcgccggctgcag
gagcaggaggagctggagaattacattgagcacgtgctgctgcaccgcccgtga

DBGET integrated database retrieval system