KEGG   Mus musculus (mouse): 387223
Entry
387223            miRNA     T01002                                 

Gene name
Mir29b-1, Mirn, Mirn29, Mirn29b, Mirn29b-1, mir-29b-1
Definition
(RefSeq) microRNA 29b-1
  KO
K16996  microRNA 29b
Organism
mmu  Mus musculus (mouse)
Pathway
mmu05206  MicroRNAs in cancer
mmu05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:mmu00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    387223 (Mir29b-1)
   05207 Chemical carcinogenesis - receptor activation
    387223 (Mir29b-1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:mmu04147]
    387223 (Mir29b-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:mmu03100]
    387223 (Mir29b-1)
Exosome [BR:mmu04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   387223 (Mir29b-1)
  Exosomal RNA of saliva
   387223 (Mir29b-1)
Non-coding RNAs [BR:mmu03100]
 Small non-coding RNA
  Micro RNA
   387223 (Mir29b-1)
SSDB
Other DBs
NCBI-GeneID: 387223
MGI: 2676905
Ensembl: ENSMUSG00000065604
miRBase: MI0000143
Position
6; 6 A3.3
NT seq 22 nt   +upstreamnt  +downstreamnt
gctggtttcatatggtggttta

DBGET integrated database retrieval system