KEGG   Mus musculus (mouse): 435273
Entry
435273            CDS       T01002                                 

Gene name
Krtap1-3
Definition
(RefSeq) keratin associated protein 1-3
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Keratin_B2 Keratin_B2_2
Other DBs
NCBI-GeneID: 435273
NCBI-ProteinID: NP_001078995
MGI: 3650443
Ensembl: ENSMUSG00000078131
Vega: OTTMUSG00000004964
UniProt: A2A588
Position
11; 11 D
AA seq 173 aa
MACCATSFCGFPTCSTGGTCGSSCCQPSCCQPSCCQPSCSQSSCCQPSCCQSSCCQPSCC
QSSCCQPCCSQTSCCQPSCCQPSCCGTGSGQEGGSGAVSCRVRWCRPDCRVEGTCLPPCC
VVSCTPPTCCQLHHAQASCCRPSYCGQSCCRPACCCYCCPPSCSESNCCEPTC
NT seq 522 nt   +upstreamnt  +downstreamnt
atggcctgctgcgctactagcttctgtggctttcccacatgttccactggtggcacctgt
ggctccagctgctgccagcccagctgctgccagcccagctgctgccagcctagctgctcc
cagtccagctgctgccagcccagctgctgccagtccagctgttgccagcccagctgctgc
caatccagttgctgccaaccttgctgctcccagaccagctgttgccagcccagctgctgc
cagcccagctgctgtggaactggcagtggccaggagggtggcagtggagccgtgagctgc
cgtgttagatggtgccgccctgactgccgcgtggagggcacctgcctgcccccctgctgt
gtggtaagctgcacacccccaacctgctgccagctgcaccatgcccaggcctcctgctgc
cgtccatcctattgtggacagtcctgctgccgcccagcctgctgctgctactgctgccca
cccagctgctctgagtctaactgctgtgagcctacctgttaa

DBGET integrated database retrieval system