KEGG   Mus musculus (mouse): 50775
Entry
50775             CDS       T01002                                 

Gene name
Krtap5-4
Definition
(RefSeq) keratin associated protein 5-4
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Keratin_B2_2 Keratin_B2
Other DBs
NCBI-GeneID: 50775
NCBI-ProteinID: NP_056624
MGI: 1354758
Ensembl: ENSMUSG00000045236
Vega: OTTMUSG00000060152
UniProt: Q62220
Position
7; 7 F5
AA seq 223 aa
MTCCGCSGGCGSSCGGCGSSCCKPVCCCVPVCSCSSCGGCKGGCGSCGGCKGGCGSCGGC
KGGCGSCGGCKGGCCQSSCCKPCCCQSSCCKPCCSSGCGSSCCQSSCCKPCCCQSSCCKP
CCSSGCGSSCCQSSCCKPCCCQSSCCKPCCCQSSCCKPCCSSGCGSSCCQSSCCKPCCCQ
SSCCKPCCCQSSCCKPCCCQSSCCKPCCCQSSCCAPVCCQCKI
NT seq 672 nt   +upstreamnt  +downstreamnt
atgacctgctgtggctgttcaggaggctgtggctccagctgtggaggctgtggttccagc
tgctgcaagcctgtgtgctgctgtgtgcctgtctgttcctgctctagctgtgggggctgc
aagggaggctgtggctcctgtgggggctgcaagggaggctgtggttcctgtgggggctgc
aaaggaggctgtggctcctgtgggggctgcaagggaggctgttgtcaatccagttgctgt
aaaccctgctgctgccagtccagctgctgcaaaccctgttgctcttcaggctgtgggtct
tcttgctgtcagtccagctgctgcaaaccctgctgctgccagtccagctgctgcaaaccc
tgttgctcttcaggctgtgggtcttcttgctgtcagtccagctgctgcaaaccctgctgc
tgtcagtctagctgctgcaagccctgctgctgccagtccagctgctgcaaaccctgttgc
tcttcaggctgtgggtcttcttgctgccagtccagctgctgtaaaccctgctgctgccag
tccagctgctgcaagccctgctgctgccagtccagctgctgcaagccctgctgctgccag
tccagctgctgcaagccctgctgctgccagtccagctgctgtgcccctgtgtgctgccag
tgtaaaatctga

DBGET integrated database retrieval system