KEGG   Mus musculus (mouse): 53906Help
Entry
53906             CDS       T01002                                 

Gene name
Phgr1, 1810007E14Rik, AA238765
Definition
(RefSeq) proline/histidine/glycine-rich 1
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 53906
NCBI-ProteinID: NP_001139116
MGI: 1858382
Ensembl: ENSMUSG00000046804
Vega: OTTMUSG00000015634
UniProt: Q8K0G7
Position
2 E5; 2 59.46 cM
AA seq 112 aa AA seqDB search
MHPGGKGHCGPPPGHGPGHCHEGHHPPGPGGPHPGHGPGHCPGGHHPPGHGGPSHGHGPG
HCPGGHHPPGHGGPSHGHGPGHCPGGHHPPGHGGPSHGHGPGHCGPHPGPHH
NT seq 339 nt NT seq  +upstreamnt  +downstreamnt
atgcatccaggtggcaaggggcattgtgggccaccccctggccatggtccgggacactgt
catgagggacatcaccctccaggacctggtggtccacaccctggccatggcccaggacac
tgtcctggaggacatcaccctccaggacatggtggcccatcccatggccatggcccaggg
cactgtcctggaggacatcaccctccaggacatggtggcccatcccatggccatggccca
gggcactgtcctggaggacatcaccctccagggcatggtggcccatcccatggccatggc
ccagggcactgtggccctcaccctggtccacatcactga

DBGET integrated database retrieval system