KEGG   Mus musculus (mouse): 544864
Entry
544864            CDS       T01002                                 

Gene name
Gm5785, EG544864
Definition
(RefSeq) predicted gene 5785
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 544864
NCBI-ProteinID: XP_011242545
MGI: 3643232
Position
12; 12 B3
AA seq 436 aa
MYKKVLLPVNFFLQPPPKLHQKSELQIRRSSKPASSRGSRRAAGVRVSRNSEAQRDVPGP
RRAAEPYQGQGARSRSSEANKPSPVRPGEGNKGPDTQRRRRKTDLTALGSSSAPAAGLGG
PDPRAGPACRQRLAPPPTLTAGSYPGSPYQTAPETAGRAGRARQAAQEKPCLVPPLPPRG
PGDKEARGSPERRQPARVPTPARGSSDPAVQSQVRAGPSAAAGRRRVHRQPGGGRRRVGR
APGGEAGEGRAGGGGANASRPPCPRPPGALRRPDPAARGDDGGRRAPSAVGYGSPQPGLP
APESPRCQSARAASSCSAHAPPVSPGASRSGVLRNGGHRLAGARRARVTPSSGLLKPAVY
QNASQRAWELGERCAAGRYRLGADGTRTAAGTRASCLPTVESREAASIEDFPHSCLRLVV
TCTSVVIPVKLLFHGR
NT seq 1311 nt   +upstreamnt  +downstreamnt
atgtacaaaaaagttcttttaccagtcaacttcttcctgcaacctccccccaaactccac
caaaaatcggagcttcagatacggagaagcagcaaacctgcgagctcaagaggaagccgc
cgagcggctggggtgcgggtctcccggaactcggaggcccagcgggacgtccccggtccc
cgccgggcggctgagccttaccaaggacaaggagcgcgtagccggagctccgaagccaac
aagccaagccccgtaaggcccggagaggggaacaaagggcccgatacgcagaggcgacgg
cggaagaccgacctcaccgcgctggggtccagctccgcgcccgccgctggactcggcggc
ccggatcctcgcgcaggcccagcctgccgacagcgcctagcgcccccgcctaccctgacc
gcaggctcttaccctggctcgccgtaccaaacagctccggaaaccgcaggccgcgcaggt
cgagccaggcaggcggcacaggaaaagccgtgtctcgtccctccccttcctccgcgggga
cccggtgacaaggaagcgagaggctcccccgagcggcggcagccagcgcgggtcccgacc
ccagcacgcggctcctcagaccctgcggttcagagccaggtccgcgcggggccgtcggcg
gcagcggggagacgccgcgtccatcgccagccgggcgggggcaggagaagggtcggccga
gcgccgggcggggaggctggtgaaggccgcgccggcggaggcggagcgaacgcctcccgg
ccgccctgcccgcggccacctggggcgctgcggaggccggaccccgcggcacggggcgac
gacggggggcgccgggctccttcggcggtcggctacggctctcctcagcccggcctcccg
gcgcccgagtcgccgcgctgtcaatccgcgcgcgccgccagcagctgctccgcgcacgct
ccgcccgtctcgcccggcgcgagccgctccggagtcctgcggaacggaggccaccgtctc
gcaggcgctcggcgtgcccgggtcaccccctcctccggacttttaaagccagcggtttac
cagaacgcttcccagcgagcctgggaactcggcgagcgctgcgcagccgggcgttatcgc
ctcggcgcagatgggaccaggacggctgcgggaactcgtgcctcctgcctgcccaccgtg
gagtcccgggaagcagccagcatcgaggacttcccacacagttgccttcggctcgtggtc
acttgtacttccgtagttattcccgtcaaacttttatttcatgggcgttga

DBGET integrated database retrieval system