KEGG   Mus musculus (mouse): 545662
Entry
545662            CDS       T01002                                 

Gene name
Pramel17, B020004J07Rik
Definition
(RefSeq) PRAME like 17
Organism
mmu  Mus musculus (mouse)
SSDB
Other DBs
NCBI-GeneID: 545662
NCBI-ProteinID: NP_001028962
MGI: 3588238
Ensembl: ENSMUSG00000035201
Vega: OTTMUSG00000008455
UniProt: Q3UTC0
Position
4; 4 C6
AA seq 476 aa
MSTYNPPTLLQLALDGVLRKDSIDFSDLEYLPITLFPPLFIKAFNSRHTEIVKKMVATWP
FPCLPVGALLKTAGVEMLQAVLDGIDILLTQNVSLRCKLQVLDLRFLHQDFWTGKQNAIC
PADILIKKQVPEGLPNYPLRQCLQVVTNLALVSSLNEHQICLLQWAQQKKDSLQLCCLKM
TIYNLPPEVISEVLDTFQPTYIVDLEIHTREVMSFLGFFAHFLGQMRNLVKFYLNQIDFY
FSVANTVTDGKIGAAKFFSQFSQLNHLQHVYMNGAYISYDNMKKLFRCLKSPLETLFFTF
CHLSMSDLRHMSDCQRLYQLKHLYLKGVVFSKSYFKSLRVLLENVSATLQTLGLEHCRMK
DSHLKVLLPALIQCSQLIFVNFFDNHFSSPVLKDLLRCMANLSKLTGERYPVPVECYNDI
GKVMVERFFQLCPELMDLLTAKRQPKKIFFATVCCPNCLRRCVYDLNTTRLCHCWE
NT seq 1431 nt   +upstreamnt  +downstreamnt
atgagcacctacaaccctcccacactcctgcagctcgcactggacggggtgctgaggaag
gattccatagacttctctgatctggagtacctgcccatcacgctcttcccaccactcttc
ataaaggccttcaatagcagacacacagagatagtaaagaaaatggtggcaacctggccc
tttccctgcctccctgtgggggcactgcttaaaaccgctggtgtggaaatgctgcaagct
gtgctggatggcatagatatactgctgacacagaatgttagtctcaggtgcaagcttcaa
gtgttggacttgagatttttgcaccaggatttctggactggaaaacagaatgccatctgc
ccagcagatattttgatcaagaagcaagtcccagagggccttcctaactatccactaagg
cagtgtttgcaggtagtcactaacctggccctagtatcttctctaaacgaacaccaaata
tgcttgctgcagtgggcccaacaaaaaaaagactctttgcagctatgctgtctgaagatg
acgatttataacctcccaccagaggttatcagcgaggtcttggacactttccagccgacc
tatattgtggatttggaaatacacacacgagaggtcatgtccttcctaggtttctttgcc
catttccttggccagatgagaaatcttgtcaaattctatctaaatcaaatcgacttctac
tttagtgttgcgaacacagtgacagatggaaagataggtgctgccaaattcttttctcag
ttctcccaactcaaccatctccagcatgtctatatgaatggtgcctacatttcctatgac
aacatgaaaaagttgttcagatgcctgaagagtcccttggagaccttgttttttactttc
tgccatctctcaatgtccgacttgagacacatgtcagactgtcagaggctctatcaattg
aaacacctatacttaaagggtgtagtgttttccaagtcatatttcaagagtctccgagtt
ctcctagagaatgtatctgcaactctacagaccctggggttagagcactgcaggatgaag
gactctcacctcaaagtcctcttgcctgccttgatccagtgctcccagctcatctttgtc
aatttctttgacaaccacttctccagtcctgtactgaaggaccttctgcgatgcatggct
aacctaagcaagttgactggagagcggtaccccgtccctgtagagtgctataatgacata
ggtaaagttatggtggagagatttttccaactgtgtcctgagctcatggatctactcacg
gctaaaaggcagcccaagaaaatcttctttgctactgtctgctgccctaattgtttgaga
cgctgtgtctatgacttgaacaccaccagactttgccattgttgggagtaa

DBGET integrated database retrieval system