KEGG   Mus musculus (mouse): 58521Help
Entry
58521             CDS       T01002                                 

Gene name
Eid1, 2610002K20Rik, Cri1, EID-1, ORF12, PNAS-22, PTD014
Definition
(RefSeq) EP300 interacting inhibitor of differentiation 1
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 58521
NCBI-ProteinID: NP_079889
MGI: 1889651
Ensembl: ENSMUSG00000091337
Vega: OTTMUSG00000015346
UniProt: Q9DCR4
Position
2; 2 F1
AA seq 159 aa AA seqDB search
MAEMAELCELYEESNELQMDVLPGEGYMEVGRGARGPAPEEGPMEEEAGPAAARAQRGLF
PEAGADLEGDEFDDWEDDYEFPEEERWSGAMHRVSAALEEANKVFLRTARAGDALDGGFQ
ARCEKSPFDQLAFIEELFSLMVVNRLTEELGCDEIIDRE
NT seq 480 nt NT seq  +upstreamnt  +downstreamnt
atggcggagatggcagagctttgcgagctgtacgaagaaagcaacgagttgcagatggac
gtgctgcccggcgagggctatatggaggtaggccgcggggcccgcgggccggccccggag
gagggccccatggaggaggaggccgggccggccgccgcccgcgcccagcgcggtctgttc
cccgaggctggcgcggacctggaaggcgacgagtttgatgactgggaggacgactacgag
ttccctgaagaggagcgctggagcggcgcgatgcacagggtgtccgccgccctggaggaa
gccaacaaggtgttcctgcgaaccgcgcgagccggagatgccctggatggcggctttcag
gcgcggtgtgagaagagccctttcgaccagctagcttttatcgaagagctgttttcgctg
atggttgtcaatcgactgaccgaagagctcggttgtgatgagatcattgatcgagagtaa

DBGET integrated database retrieval system