KEGG   Mus musculus (mouse): 66323Help
Entry
66323             CDS       T01002                                 

Gene name
1700001K19Rik
Definition
(RefSeq) RIKEN cDNA 1700001K19 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 66323
NCBI-ProteinID: NP_079764
MGI: 1913573
Ensembl: ENSMUSG00000056508
UniProt: Q80ZT1
Position
12; 12 F1
AA seq 219 aa AA seqDB search
MASQRPSRPTCIRAAFSAAGFRKWQRHARHRLQVSSRRNLMDLAEGIWREFLDPYDGDSE
DTPGHSNYRSYHSHRAHHLLGDRNRNSPSYTLKFRTAEEASVEDSLPKAPDLTMKASVWA
PAALEVHDVDMQPEGELKTNGCPGRLSPSPEDWRMTRAASPLNPVETQEIGRQLLGRARA
TRSPPRLGSDRDKGTRLSLSKRKLELLLGEPERIKRKKK
NT seq 660 nt NT seq  +upstreamnt  +downstreamnt
atggccagccagaggcccagccgacccacctgcatcagggcagcctttagtgcagctggc
tttcggaagtggcagagacacgcgcgccatcgccttcaggtcagctccagaaggaacctc
atggaccttgctgaaggcatctggagagagtttttagatccttatgatggtgactcggaa
gacaccccaggtcattccaactatcgcagttaccatagccatcgtgcccaccacctcctg
ggtgataggaaccgcaactcgccttcctacacactgaaattcaggactgctgaggaggcc
agcgtggaagactcgctcccaaaggctccagacctcaccatgaaagcttctgtctgggcc
cctgcagccctcgaagtccatgacgtcgacatgcagcctgagggtgaactaaagaccaac
gggtgtcctggcagactgtccccatcaccagaggactggaggatgacaagggctgccagc
cccctcaatcctgtggagacccaagagataggcagacagctgctgggcagagccagagcc
acccggtcaccacccagactcgggagtgacagagataaggggaccaggctgtcgctttcc
aagagaaaactggagctcctacttggagagcctgagagaattaagaggaagaagaagtaa

DBGET integrated database retrieval system