KEGG   Mus musculus (house mouse): 66780
Entry
66780             CDS       T01002                                 
Symbol
4933436I01Rik
Name
(RefSeq) RIKEN cDNA 4933436I01 gene
Organism
mmu  Mus musculus (house mouse)
SSDB
Other DBs
NCBI-GeneID: 66780
NCBI-ProteinID: NP_080039
MGI: 1914030
Ensembl: ENSMUSG00000025288
Position
X:complement(66963470..66965056)
AA seq 429 aa
MDKLEESAEDTDSWTSHTNLTKNKIFLKPVSRGSGKNYTEYICISSEQNVQVLKRVKKSQ
KKRPKGKFWEKHTTPLCKPTEEGGGTPHPGKNKRQKKKRKTRHERNKMLQDKLKMLWGQY
AQLQSEINILLDQYSHLPDGVKTKCNHHKNRMHKNRNTPCGQDKHLKKLVITQFDPDKQV
KEEISRHYYQDRREKEDKIKLLSHDQQGQEERITHFEQKKHVKRNTKLYRNKRVKKKMIR
HYYQDKYAKEDKIKLLSQDQQEQEERITHFDQNKEVERNTQFYQGKQEKEKTIRHYYQDR
HAKEHKITLFIYDQQGQEDVITHLDQNNQEERNTLFDHGNQVKEERIKFCFPNKKVDEER
TTFCSPEKQENGEIPVPFYQHTPLHGGMTILQLHEQVAGDYAQEASTDARMHSWDNYLHC
LYYTDISQL
NT seq 1290 nt   +upstreamnt  +downstreamnt
atggacaagttggaagagagtgctgaagatacagactcatggacttcacatactaacctg
acaaagaacaagattttcctaaagcctgtatctaggggttctggcaagaactacactgaa
tacatttgcataagtagtgaacagaatgtacaggtcctaaaaagggttaaaaaaagtcag
aaaaagagaccaaagggaaagttctgggaaaaacataccacccctctatgtaaacctaca
gaagaaggtggaggaacaccacaccctggaaaaaacaagcggcagaaaaagaagcgtaaa
acgcgacatgaacgaaacaaaatgctgcaggacaagctgaagatgctgtggggtcagtat
gctcagctacagagtgagataaatatactattggatcaatactctcacttacctgatgga
gtgaagacaaaatgtaaccaccataaaaaccggatgcacaagaacagaaatacaccatgt
ggtcaagacaaacatctcaaaaagttggtgatcacacagtttgatccagacaaacaagtt
aaagaagagataagcagacactactatcaagacagacgtgaaaaggaagataagatcaaa
ctactcagtcatgaccagcaaggacaagaagagagaatcacacactttgaacaaaaaaag
cacgttaagaggaacacaaaactttatcgaaacaagcgtgtgaaaaaaaagatgatcaga
cactactatcaagacaagtatgcaaaggaagataagatcaaactactcagtcaggaccag
caagagcaagaagagaggatcacacattttgaccaaaataaggaagtagagaggaacaca
caattttatcaaggcaaacaagagaaagaaaagacgatcaggcactactatcaagacagg
catgcaaaagaacataagatcacactattcatttatgaccaacaagggcaagaggatgtg
atcacacacttagaccaaaataatcaagaggagaggaacacactatttgatcatggcaat
caagtgaaagaggagaggatcaaattttgctttccaaacaagaaggtagatgaagagaga
accacattctgctctccagaaaagcaggagaatggggagataccggtccccttctatcaa
cacacacccctgcatggagggatgaccattctgcaactacacgaacaagtagcaggagat
tatgcacaggaggcaagcacagatgcaaggatgcatagctgggacaattaccttcattgc
ttgtattatacagacatcagccagctatga

DBGET integrated database retrieval system