KEGG   Mus musculus (house mouse): 67507
Entry
67507             CDS       T01002                                 
Symbol
1700019N19Rik
Name
(RefSeq) RIKEN cDNA 1700019N19 gene
Organism
mmu  Mus musculus (house mouse)
SSDB
Other DBs
NCBI-GeneID: 67507
NCBI-ProteinID: NP_080484
MGI: 1914757
Ensembl: ENSMUSG00000026931
UniProt: Q9CQT6 A0A0R4J076
Position
19:complement(58774233..58782846)
AA seq 237 aa
MLKPAESKMESPKTFMRKLPITPGYCGFIPWLSCQESSSEDRMNPCVKAFQERTQRYKED
QQGLNCSVANTPPLKPICSEDTVLWVLHEYAKKYHPLTLECKNEKKPLQEPPIPGWAGYL
PRARVTEFGYATRYTIMAKKCYKDFLDLVEQAKRAQLKPYEQTYDVRAAQPLSPSSKILQ
LQGLSPAFPEFSGPGQTPPSEDPQAPRPCGCAQWSSQSCSRNVYGEPPSLAKAFAES
NT seq 714 nt   +upstreamnt  +downstreamnt
atgctcaagccagcggagagtaaaatggagtctcccaagaccttcatgagaaagctgccc
atcactccaggatactgcggcttcataccatggctcagttgccaggaaagctccagcgag
gaccgcatgaatccctgtgtgaaagcgttccaggagagaacgcagagatacaaggaggac
cagcagggattaaactgctctgtggccaacaccccacccctgaagcccatctgttctgag
gacacggtcctgtgggtgttgcatgagtatgccaagaagtaccaccccctgactctggaa
tgcaaaaacgagaagaaaccgctgcaggagccccctatccctggctgggcaggctacctg
cccagagctagggtcactgaatttggctatgccacaaggtataccatcatggccaaaaag
tgctacaaggacttcctggatttggtggagcaagccaagagggctcagctgaagccatat
gagcaaacatacgatgtgagggctgcccagcctcttagcccttcttcaaaaatcttgcag
ctgcaaggtctctcacccgcatttccagaattctctgggccaggtcaaacacccccaagt
gaggacccccaagctcccaggccctgtggttgtgctcagtggtccagccagtcatgcagc
aggaatgtgtatggggagccaccatccttagcaaaggcttttgccgagagctag

DBGET integrated database retrieval system