KEGG   Mus musculus (mouse): 69202
Entry
69202             CDS       T01002                                 

Gene name
Ptms, 2610009E16Rik
Definition
(RefSeq) parathymosin
Organism
mmu  Mus musculus (mouse)
SSDB
Motif
Pfam: Prothymosin
Other DBs
NCBI-GeneID: 69202
NCBI-ProteinID: NP_081264
MGI: 1916452
Ensembl: ENSMUSG00000030122
Vega: OTTMUSG00000024455
UniProt: Q9D0J8
Position
6; 6 F2
AA seq 101 aa
MSEKSVEAAAELSAKDLKEKKDKVEEKAGRKERKKEVVEEEENGAEEEEEETAEDGEDDD
EGDEEDEEEEEEDEGPVRKRTAEEEDEADPKRQKTENGASA
NT seq 306 nt   +upstreamnt  +downstreamnt
atgtcggagaagagcgtggaggcagcggccgagctgagtgccaaggacctgaaagaaaag
aaggacaaggtggaggagaaggccggccggaaagaacggaagaaagaagtagtggaggag
gaggagaatggagctgaggaagaggaagaagaaactgcagaggatggagaggatgatgat
gaaggggatgaagaagatgaggaagaagaggaggaggatgaaggccccgtgcggaagaga
actgctgaagaggaggatgaagcagaccccaagaggcagaagacagaaaacggggcgtcg
gcatga

DBGET integrated database retrieval system