KEGG   Mus musculus (mouse): 69380Help
Entry
69380             CDS       T01002                                 

Gene name
1700013G24Rik, AI507018
Definition
(RefSeq) RIKEN cDNA 1700013G24 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 69380
NCBI-ProteinID: NP_081339
MGI: 1916630
Ensembl: ENSMUSG00000041399
Vega: OTTMUSG00000009878
UniProt: Q9DAC6
Position
4; 4 D3
AA seq 286 aa AA seqDB search
MSGRQVSRSNTYNHLSQPNNVSFPPRTPGWTQYPNMNNGKGLRSRLPSGSELSTSSGQSG
HSEQSFNSTTSSELPLGKICMGRPYTSKCVETSHLTRGPKVVKKPTCQRSSPHCLICTDQ
PSCPSSPTFLDQLIKGISYLDRSTNVFNNSSYPKALSLPQLAATYLERAANSLYLDQTER
PPPRSYSTPSTSTAAANQPPANNCLVPSTRDTKSLQCLGSTGLNYQQRPNSQTFNVETPQ
RPGVKLPEIPLFGNGFFSLGRLPKFWEAIRSGWNAPVPTPKPEGWW
NT seq 861 nt NT seq  +upstreamnt  +downstreamnt
atgtctggacgccaggtaagccggtccaacacttacaaccacttgagccaacccaacaac
gtgtccttccctcctcgaactccaggctggacccagtatcccaatatgaacaacggcaag
ggtctgcgaagccgccttccaagcggctccgagttaagcacctccagcggccaatctggc
cactccgagcaatccttcaactccaccacctcctcagaacttcccttggggaagatctgc
atgggccgcccctatacctccaagtgtgtagagacgagtcacctgacgagaggccccaag
gtggtcaaaaagcccacctgtcaacgcagcagccctcactgcctgatctgcacagaccaa
ccatcgtgcccctccagtcctaccttcctagaccagctcatcaaaggcattagctacctg
gacagatccaccaatgttttcaacaacagcagctaccccaaagccctgagcttacctcag
ctggcggctacctatctggaaagagctgctaactccctctacctggaccaaacggaacgc
cccccaccccgaagctattccactcccagcactagcacagccgctgccaatcagccccca
gccaacaactgcttggtcccttccactcgggacaccaagagcctgcagtgcctgggttcc
actggtttgaactatcaacaacggcctaacagccagactttcaatgtcgagacacctcag
aggcccggggtaaaactgccagagattcccctgttcggcaacgggttcttctccttaggt
cgtctgcccaagttctgggaagcaatccgttccggatggaatgctcctgtgcccacccct
aagcccgagggctggtggtga

DBGET integrated database retrieval system