KEGG   Mus musculus (house mouse): 71248
Entry
71248             CDS       T01002                                 
Symbol
4933428M09Rik
Name
(RefSeq) RIKEN cDNA 4933428M09 gene
Organism
mmu  Mus musculus (house mouse)
SSDB
Other DBs
NCBI-GeneID: 71248
NCBI-ProteinID: NP_001344785
MGI: 1918498
Ensembl: ENSMUSG00000042525
Position
X:138079977..138081758
AA seq 192 aa
MSAVAAQEPGLPDQEGGGGGMGDDPRQIVLHVLPIEEAAADIDGTAAFLVSQAVVRAIAE
EEGGQEELLPDVEEIWPPVEEVWPDIEDIWPAIEAVWPDVEEDWYIWNDGRENDEDQRQV
GDQQDYNKEGEEENDDDDDDDDEEDDDDYEYEEDDDDYEYEEDDDDYEYEEDEDDNEGED
NEDQGEIILRAY
NT seq 579 nt   +upstreamnt  +downstreamnt
atgtctgctgttgcagcacaggagcctggattacctgaccaagagggaggtggtggtggg
atgggggacgaccccagacaaattgtcctgcacgtgctgccaattgaagaagctgctgct
gacatcgatggaaccgcagcatttctggtttcacaggcagtggtgagagccatcgcagag
gaagagggtgggcaggaggagttattgcctgatgttgaggagatctggccacctgtggaa
gaggtctggcccgatattgaagatatctggcctgcaattgaagcggtctggcctgatgtt
gaggaagactggtacatctggaacgatggccgggagaatgatgaagatcagaggcaagtt
ggagaccaacaggattataataaggaaggagaggaggaaaacgatgatgatgatgacgac
gacgacgaagaggatgacgatgattatgagtacgaagaggatgacgatgattatgagtac
gaagaggatgacgatgattatgagtacgaagaggatgaggatgacaacgaaggggaagat
aatgaagatcagggggagattatcctgcgtgcctattga

DBGET integrated database retrieval system