KEGG   Mus musculus (mouse): 73884Help
Entry
73884             CDS       T01002                                 

Gene name
Zdbf2, 4930431J08Rik, 9330107J05Rik
Definition
(RefSeq) zinc finger, DBF-type containing 2
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 73884
NCBI-ProteinID: NP_001254801
MGI: 1921134
Ensembl: ENSMUSG00000027520
Vega: OTTMUSG00000002659
UniProt: Q5SS00
Position
1; 1 C2
AA seq 2493 aa AA seqDB search
MEAQSYQEVMKNNGQHLFSSQHRSLTRQSRRRTATNNTLMERFLQDVLRHHPYNYQDNRS
APNEPEAAAAAAAAADPGSPEVVVVLDDSDEKEDDTADSGAERNSEDSGSVEEIDYRPGT
SQEHAEVAVRPSVIQKLERGQQQSLELAHKVESGVKKVNSVGVVQATTSGKKLVRPPVIC
NAPASSLPSGSFERPVAANSVPRLVLAVASDSFPACDTENLETYFDSPDQGPSNPSSQPK
TKDPKKKLSINLDKLLAQRNLRAKGASFSPVVRVRELTGSELCSVRAESSELEAGTAGNP
RETDTLPEQAREGAIPKRREASRSNTVRPQEETRLVLNKPTLLKQKRSVSSEERFSCGSR
QAVPGPSQAAVRDLSLLEEEVEEEKQEEEEEEEQEEEEEHEEEEEGVDQEDASYESRGSD
MSFDCGSSCQSLSALSELTAREINVSEETHAYSQPRNETPTVSGATSDNGSSSRQVITQN
IQLISLVDESYESSGSEVNFDGDDSLPSTSHRPPQPVEVVVPLRLVDKSYGSGSSEPCED
SGSSADETPAASRQQNPVRNTHANLVDENYGSSSFSSDSDAALDHPQVPVQEGSPRGRAV
GQGNEEQPSSAEAHPERDGSLETVAHELQRESQEINLPNQKNTSLGDMNCESHGPEVGFH
ADAQLEADQSPVNPEEVDLDLENQSVHSGISNLSFDSNASYQSANDQPQGAWGEVNLDEL
NVDMEVKSNGCSSSELTFDSDSPLLSVTERSLLDFEGLNEDDFNLEDENCVSSSSDITFD
SDIPDDSVADQPQVAVYEEEPVGLENKSNESCVSGITFDSDIPLHSGNDHPEVAVKEVII
KEDENVHLEGKNDNPSGSEICLDSNVPLHSVTNSDVAVKKINPPKEDQVQIEQIEQKENE
PTDSELNLDCNSVNSKPGCSEDPIILRVSETRLDSHVPFQSVIRKCEVVVKNVCLQKEKH
AELTSKSTESHSEVSSASTASHPVTEPYVGKKAKRKTKHLEEVNSDDEYGGSQPTFKFDV
FPRTMTEKPQPAALKEGHADPKDKITELRGMAVNVNTADCLDSVLSQPQLASNENCVELK
DTDGKPSDSKASADSTGHFHSLPKQEFDVVSKMNEWKKEAKVLEQKISDLIYSKIIHDSN
VSFRSAMDQLELALKQISLGNNDQVSLEDNSQDTCSETNLDSGFSVQAVVEPPEPEVTVL
EPEHVEQEGRNNVPCDSEVSVDANGSVQLEAGQHSESGENRSQKDTDDTEGKRDDAQGFG
ITCDSNVPQPLAGHIEVVQDIDHWKDHVDLEDKLGESKNSKVNFHSDEPLQAVTNATQEP
VEEINLPRGRASPNGNGCEPYGSTIVPVTNVIFCSVIQKPQRLQKKCTSLKENSSNPCPE
VNVDSCDGPEVSVDSNDPCQSVAGHLQKPDKEMNLKEDHIYLEDKSYKLVDFEPTYDSDD
PVQFVTVPSVEAVSIKEVNLQKENPDDLENENFQPCCSEVACNSAVHLQSEADPPQVACK
EADLDKKALDIEDKGSVTCVPEVVYDSDVSFQIVVNQVQTSDGETDSPQVVFVDVVSSDS
DCDREVISDSNIPLQLEPPQMTVKETSDINTDSLGSAANEKYYCKFCGCDYEASQSVTNQ
SKESFKIINRKNDYIILGDSTCPSCGHELNFNVDPSDQPTTCQLQQPDRNFIDPEDKNFG
SKCPKRKLNWEDTAHPVTHQLQKTGEATSLRKDQKNRFKRDRGWESSSFAGDHAAYAVSV
IRQTALNSCGSELNFQDDTFYHSDIDPPQPKKKGQGKKVTFDLRVTKYEYPPNPMYGEGE
EVAEDDLKEVVVHEASPQGQAPPSIVGKTCPQGREDDVKTNTQACQGYFYSYYDGGSETK
KILLGEEEKTIRSDLNQNTTSIQHVKGKVGDTGDFSVDLGKQSCSLAEGLHQQHGQVTSQ
NQVEVRCGIQASSGKKRKITEQEEDSPKRKCFHHDSQKKKKAQAGITELPEPQTKVLEPV
QPDSLVYIFSSLSMKEDQSLNPPKTKPGSDSDLPHIYSCREHTSSGPRRKRTVINPPQNL
MVPEVGIDLNRHDPKPNAGDDSAKRQNLVSTSFMAMPKKSVLKFQRTNQSSFLKKSEDVG
ATQVPKDNFQQTLVNRDGAKKFPKSVKKEDLESQNQRKFWKKKMVAANKLCLIKNAYKTM
VLRKKSKLASEKLAIWIQLKATDIIRKYVSRCHGLMPRRHLSKTVLIRMQLRKKKIVARK
IKEAKRAAEALALKLSRPSCPPRAPCPPRALCPPRAPCPPRALCPPRAPCPPRALCTPRA
PCPPRALCTPRAPCPPRALCTPRAPCPPRALRAPCPPRALCSPRAPCPPRALCPPRAPCP
PRAPRAPCPPRAPCPPRAPCLPRAPCPPRAPCPPRAPCLPRAPCLPQAPCPPRALCLPRV
SCPPLPLCAPCPPCAPVLPAGAEEQLSTTAGPAELPAHLSNAGGIKRYRKTYFRRRKRLL
PVREYDLRSLSSTTNTDRMVTRLASKSKSNEAK
NT seq 7482 nt NT seq  +upstreamnt  +downstreamnt
atggaagctcagagctatcaggaagtaatgaagaacaatggacagcacttgtttagttct
cagcacagaagcctgaccagacagagcagacgtcggacagctactaataacactctgatg
gaacgctttttgcaggatgttctgcgacaccacccatataattaccaagacaacagatct
gcaccaaatgagccagaggcggcggcagcagcggcagcagcagcagatcctggatcacct
gaagtggtggtggttttggatgattctgatgagaaggaggatgatactgcagatagcggt
gcagagaggaactccgaggattcaggatctgttgaagagatagattatagacctggtact
tctcaggaacacgcagaagttgcagttcgaccatcagttattcaaaaactggaacgggga
cagcagcagtccttggaattggctcataaagttgagagtggtgtgaaaaaagttaattca
gtcggtgttgttcaggctacaactagtggaaaaaagttagtgcgtccccctgtgatttgt
aatgctcctgccagctctttgcctagcggctctttcgagagaccagttgcggctaacagt
gttcctcggttagtactggcagttgcttcagattcttttccagcttgtgacacagagaac
cttgaaacatactttgactccccagatcagggccctagcaacccatcatctcaacccaaa
actaaagacccaaaaaagaaactaagtataaatttagacaaattgcttgcacagagaaat
cttagggctaagggtgcgtctttttcccctgtcgtacgagtccgtgagctaacaggttct
gagctttgttctgtaagagctgagtcttctgagttagaggcaggtacagcaggaaacccg
agggagactgacacactaccagaacaagcacgtgaaggtgccattccaaagcgtcgtgag
gcatctcgttcaaatacagttcgtccccaagaagaaacacgtttggttcttaacaagcca
acacttctgaaacagaagcgctcagtgagttctgaagagaggttcagttgtgggtctcgt
caggcagtacctggtccttcccaagctgctgtacgtgacttaagtcttttggaggaggaa
gtggaggaggagaagcaggaagaagaggaagaggaggagcaggaagaagaggaggagcat
gaagaggaggaggagggagttgaccaagaagatgcgagttatgaatctagaggttctgac
atgagttttgattgtgggtcctcttgtcagtcgctgagtgccctatctgaactgaccgcc
agagaaataaatgtatcagaagaaacacatgcttattctcagcctaggaatgaaacaccc
actgtttctggagcaacttcagataatggtagcagttctcgtcaggtgattacacagaac
atacagctcattagtctggttgatgaaagctatgagtctagtggctctgaagtgaatttt
gatggtgatgactcactaccgtcaactagtcaccgtcccccacagcccgtggaagtagta
gtgccccttcgtttggttgacaagagctatggaagtggtagctctgaaccatgtgaggat
tccgggtcctcagctgatgagactccagcagcatcaagacagcagaatcctgtgaggaac
acccatgcaaacctggttgatgagaactacgggtcaagtagtttcagctctgacagtgat
gcagctctggaccatccccaggtgcctgttcaagaaggaagccccagaggcagagctgtc
ggacagggaaatgaagagcagcccagtagtgctgaagcacatcctgaacgtgatggttct
cttgagacagtggctcatgaactccagagagaatcacaagaaataaaccttccgaaccag
aagaataccagccttggggatatgaactgtgagtctcatggtcctgaagtgggttttcat
gctgatgctcaattagaggctgatcaatctccagtaaaccctgaggaagtagatcttgac
ctagaaaatcagagtgttcactctggcatttctaacctaagttttgattccaatgcttct
tatcagtcagctaatgatcaacctcaaggggcttggggtgaagtaaatctcgatgagtta
aatgtcgacatggaagttaagagcaatggctgctccagttctgagttgacatttgattcc
gattcccctcttctgtcagttactgagcggtctctgctggattttgaaggattaaacgaa
gatgactttaacctggaagatgaaaactgtgtgtcaagtagttctgacataacttttgat
tctgatattcccgatgactcagtagctgaccaacctcaagtagctgtttatgaggaggaa
cctgttggtctggaaaataagagtaatgaatcttgtgtttctggaataacatttgattct
gatattcctcttcattcaggaaatgatcaccctgaagtagctgttaaagaagtaatcatt
aaggaagacgaaaacgttcacttagaagggaagaatgacaatcccagtggttctgaaata
tgtttggattctaatgtccctcttcattcagtgactaattctgatgtagctgttaaaaag
ataaatccccccaaagaagatcaggtacaaatagaacaaattgaacaaaaggaaaatgaa
cctactgattctgaattaaatttggattgtaactctgttaattcaaagcccggatgttct
gaagatcccattatattacgtgtttctgaaacaagattggattctcatgtcccctttcag
tcagttattcgcaaatgtgaagtagttgtcaaaaatgtctgtcttcaaaaagaaaagcat
gctgagttaacaagtaaaagcacggaatctcattctgaagtaagttcagcttctactgct
tctcacccagtgacagaaccttatgtaggtaaaaaggcaaagagaaagacaaagcatctt
gaggaagtcaacagtgatgatgaatatggtggctctcaaccaactttcaagtttgatgtt
tttcctcggacaatgactgaaaaacctcaaccagctgctttgaaagagggccatgctgac
ccaaaagataaaattactgagcttagagggatggccgtaaatgtgaatactgctgattgt
cttgattcagtccttagccagcctcagttagcctcaaacgaaaactgtgttgaactgaaa
gacaccgatggcaaacccagtgactctaaagcaagtgctgattctactggccattttcac
tccctgcctaaacaagagttcgatgtggtttcaaaaatgaacgagtggaaaaaagaggca
aaggttcttgaacagaagatcagtgatcttatttattcaaaaataatacatgactctaat
gtttcttttcgttctgcaatggatcaacttgaactagctcttaaacaaataagtcttggt
aataatgaccaagtgtccttggaagataacagccaagatacatgttctgagacaaatttg
gattctggtttctcagtccaggcagtagttgaaccacctgaacctgaagtaactgttttg
gagcctgaacatgttgaacaagaaggtagaaataacgtgccttgtgattctgaagtaagc
gttgatgctaatggctctgtccagttagaggctggtcagcatagtgaaagtggtgaaaac
agaagtcagaaggatacagatgacacagaaggtaagagggatgatgctcagggttttgga
attacatgtgattccaatgtcccccagccattggccggccacattgaagtagttcaggac
attgaccattggaaggatcatgttgacttggaagataagcttggtgaatctaaaaactca
aaagtaaactttcattctgatgaaccacttcaggctgtgactaacgcaacacaagagcct
gttgaagaaataaatttaccgaggggacgtgctagtccaaatggtaatggctgtgagccc
tatggctctacaatagttcctgttacgaatgtcattttttgctcagtgattcaaaaacca
caacgtttgcaaaaaaagtgtaccagtttgaaagaaaacagcagcaatccttgtcctgaa
gtaaatgttgattcctgtgatggtcctgaagtgagtgttgattctaatgatccctgtcag
tcagtagcaggccaccttcaaaaacctgacaaggaaatgaatctgaaggaagaccatatt
tacctggaagataagagctacaagctagttgactttgaaccaacttatgattctgacgat
cctgttcagtttgtgacagttccatctgtagaggctgtgtctatcaaagaagtaaacttg
caaaaggagaatcctgatgacctagaaaatgagaactttcagccatgttgttctgaagta
gcatgtaattctgctgttcatctgcagtcagaagctgacccacctcaagtggcttgcaaa
gaagcagaccttgacaagaaagcgcttgacatagaagacaagggcagtgtaacttgtgtg
cctgaagtggtgtatgattctgacgtctcttttcagatagtagttaaccaggttcagaca
tcagatggagaaacagactcaccacaggtggtgtttgtggatgttgtgtccagtgatagt
gactgtgaccgggaagtaatttctgattcaaatatccctcttcagctagagccacctcag
atgactgtcaaagaaaccagtgatataaacacagattctcttggttctgcagcaaacgaa
aagtactattgtaaattctgtggttgtgattatgaagcctctcagtcagtgacaaaccaa
tccaaggaaagttttaaaataataaacaggaaaaatgactatattatcctaggcgattct
acttgtccatcttgtggtcatgaactcaatttcaatgttgatccttctgatcagcccact
acctgccagttacaacagcctgatcgtaattttattgacccagaagataagaactttgga
tctaaatgtcctaaaagaaaattaaattgggaagatactgctcatccagtgactcaccaa
ctacagaaaactggagaagccaccagtcttcggaaagatcaaaaaaatagattcaaaaga
gataggggctgggaatccagtagttttgcaggagaccatgctgcctatgctgtgtcagtg
attcgccaaacagctttgaactcctgtggatctgagctaaactttcaagatgataccttc
tatcactctgacattgacccacctcaacctaagaaaaaaggccagggtaagaaagtgact
tttgacttgagagtaactaagtatgaatatccaccaaacccaatgtacggggaaggagaa
gaggttgcagaagatgatcttaaggaagtagtagttcatgaagcctcacctcagggtcag
gctcctccatcaattgttggaaaaacatgtcctcaggggagagaagatgatgtgaagaca
aacacacaggcatgtcaaggttatttctatagttactatgatggtggctctgagaccaag
aaaattcttttgggtgaagaagaaaagaccattaggtctgaccttaatcagaacaccaca
tcaattcaacatgttaaaggtaaagttggagacactggtgacttttcagtggacttaggt
aaacagtcttgttccttagcagaggggcttcatcagcaacatgggcaggtgacttctcag
aaccaagtagaagtgagatgtggaattcaagcaagttctgggaagaaaaggaaaattaca
gaacaagaagaggactcaccaaagaggaagtgtttccaccatgatagccagaagaagaaa
aaggctcaagctgggataactgagctacctgaaccacaaactaaagttttagagcctgta
cagcccgattccttggtctatattttttcttctctaagtatgaaggaagatcagtctttg
aatccacctaaaacaaagcctggcagtgacagtgatttgccacatatatacagttgtaga
gaacacacctcttctggcccacgacgtaagagaactgtaattaatcctccacagaaccta
atggtaccagaagttggcattgatcttaataggcatgacccaaagcccaatgcaggagac
gatagtgccaaaagacaaaacctggtttcaacatcttttatggcaatgccgaaaaaatct
gtgttaaagttccagaggaccaatcaatcttcatttctaaaaaaatcagaagatgtgggt
gctactcaagttccaaaggataatttccagcagactcttgtaaatcgtgatggtgccaaa
aaatttcccaaatcagttaaaaaggaagatcttgaaagtcaaaatcaaaggaaattttgg
aaaaagaagatggttgctgcaaataaattatgcctcatcaaaaatgcgtataaaacaatg
gttctccggaaaaaatcaaaactagcttcagaaaagctggctatttggattcagctgaaa
gcgaccgacatcatcaggaagtatgtctctagatgccatggtcttatgccccggaggcat
ctatcaaagactgttcttataagaatgcaactgaggaagaagaaaatagttgccaggaag
ataaaggaagccaagagagcagctgaagcactagcgctcaagctctcgcgcccctcgtgt
cccccgcgggccccgtgccccccgcgggccctgtgcccccctcgcgccccgtgccccccg
cgggccctgtgcccccctcgcgccccgtgccccccgcgggccctgtgcacccctcgcgcc
ccgtgccccccgcgggccctgtgcacccctcgcgctccgtgccccccgcgggccctgtgc
acccctcgcgccccgtgccccccgcgggccctgcgcgccccctgccccccacgggctctg
tgctccccgcgcgccccgtgccccccgcgggccctgtgcccccctcgtgccccgtgcccc
ccgcgagccccgcgggccccgtgccctccgcgggccccgtgccctccgcgggccccgtgc
ctcccgcgggctccgtgccccccgcgcgctccgtgccccccgcgcgccccgtgcctccca
cgcgccccgtgcctcccgcaggctccgtgccccccgcgggccctgtgcctcccgcgggtt
tcgtgccccccgctccccctgtgcgccccgtgccccccgtgcgccccggttctcccagct
ggtgctgaagagcagttgagcactactgcaggacctgcagagctgcctgctcatctttcc
aatgctggaggaataaagcgctacaggaaaacttacttccggagaaggaagagacttctt
ccagtgagagaatatgacctgagaagcttgagttccacaacaaataccgacaggatggtg
acacggcttgcaagcaagtcgaaaagcaatgaggcaaaataa

DBGET integrated database retrieval system