KEGG   Mus musculus (mouse): 74268Help
Entry
74268             CDS       T01002                                 

Gene name
Aven, 1700013A01Rik, 1700056A21Rik, mAven-L, mAven-S
Definition
(RefSeq) apoptosis, caspase activation inhibitor
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 74268
NCBI-ProteinID: NP_083120
MGI: 1921518
Ensembl: ENSMUSG00000003604
Vega: OTTMUSG00000015148
UniProt: Q9D9K3
Position
2; 2 E3
AA seq 342 aa AA seqDB search
MQAERGARGGRGRRGGRERPGGDREPVGAATALARGGCGDGGGRRGRGRGFRRGRGGGGL
RGGRWEPGGRGGGASTRVEEDSDSETYGEENDEQGNFSRRKIVSNWDRYQDTEKEVNGES
GESQRGTDFSVLLSSAGDSFSQFRFAEEKEWDGETSCPKQNSALYVDSESLVRALEQLPL
AVRLNVASELIQTTIPLELPQVKPRRNDDGKELGMHLRGPISELRSAAGACPRSLGRGSL
RQSPLEGLQKAPTPTQSVADHLEEELDMLLHLDAPVQEEGNISPDQTSRDQEPEKDGQVA
QEETGPEKPSVTREKNVEPEQPSTSKNVTEEELEDWLDSMIS
NT seq 1029 nt NT seq  +upstreamnt  +downstreamnt
atgcaggctgagcgcggggctaggggcggccgcgggcggcggggaggccgggagcggccc
ggaggggaccgagagccggtcggggcagcgacggcgctggcgagaggaggctgcggggac
ggaggcggccggcggggccgaggccggggcttccgccgaggccgaggaggtggcggcctg
cgaggcggccgctgggagcctggaggccggggcggcggagccagcactcgggtggaagaa
gacagcgattcagagacctatggagaagagaatgatgagcaaggaaatttttctagaaga
aagattgtctccaactgggatcgctatcaagatactgaaaaggaggtcaatggtgaaagt
ggagaatctcagcggggcacagacttcagtgtcctcctgagctctgcaggggactccttt
tcacagttccgatttgctgaggagaaagaatgggatggtgaaacttcatgtccaaaacag
aattcagcactctacgtggacagtgagtcactggttcgagcccttgagcagctgcctctt
gcagtccggcttaatgttgcttcagaattgatccagaccacaattcctttagaacttcca
caggtgaaaccaaggagaaacgatgatggcaaggagctgggcatgcatttaaggggaccc
atctctgagctcagatctgctgctggtgcttgccccaggtctctgggcagaggcagtcta
aggcaaagccctttagaaggtttgcagaaagcacctaccccaacacagtcagtggcagac
cacctggaagaagaactagatatgttgctgcatttagatgcacctgtgcaagaggaaggc
aatatctctccagaccagacatctcgggaccaggaaccagaaaaagatgggcaggtagcc
caggaggaaacaggtcctgaaaaaccttctgtgaccagagagaagaatgtggaacctgag
cagccaagcacatcgaagaatgtcaccgaggaagagctggaggactggctggacagcatg
atttcctga

DBGET integrated database retrieval system