KEGG   Mus musculus (mouse): 74892Help
Entry
74892             CDS       T01002                                 

Gene name
4930447A16Rik
Definition
(RefSeq) RIKEN cDNA 4930447A16 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 74892
NCBI-ProteinID: NP_083389
MGI: 1922142
Ensembl: ENSMUSG00000022288
Vega: OTTMUSG00000028028
UniProt: Q9D5F6
Position
15; 15 B3.1
AA seq 132 aa AA seqDB search
MTSFIYSGRQGALRWGGCTVPRALRALHQSETQQSCGILHAIIYDHEYYLFLNWSYKFTR
DFWQRGKATFRSQTPVSILQKERTDHSSDEDVGEDCASLRRQILAGESGSLEKSPMSSVC
VPLHLVTLQTLL
NT seq 399 nt NT seq  +upstreamnt  +downstreamnt
atgactagttttatttattcaggaagacagggagccttgcgttggggaggatgcacagtc
ccacgggccttgagagctttgcatcagtcagagacgcaacaatcctgtggcatccttcat
gcaataatttatgaccatgaatattatttatttctgaattggagctataaattcaccagg
gatttctggcaaagaggaaaagctactttccgaagtcaaacgccagtctccattttacaa
aaagaacggactgaccactcaagtgatgaagatgtcggggaagattgtgcaagcttaagg
aggcagatccttgctggagaaagtggatcactggagaaaagtcccatgtcctctgtatgt
gtgccactccacctggtcactctgcagacattactctag

DBGET integrated database retrieval system