KEGG   Mus musculus (mouse): 76657Help
Entry
76657             lncRNA    T01002                                 

Gene name
1700125G22Rik
Definition
(RefSeq) RIKEN cDNA 1700125G22 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 76657
MGI: 1923907
Ensembl: ENSMUSG00000097584
Position
3; 3 A3
NT seq 861 nt NT seq  +upstreamnt  +downstreamnt
ggagtgcccggatgtgggcttgaggaggcgtggctctgcagcgcctctggatgcagcagg
tgtttctgtggttaccgcttgtttactccgtaaacagcccagttcctgatgaacggtctc
tctgccatcacctccaacttcaagaaaaagtaccaagcaccgcaaaccgatccgctctta
ctactaaccagattttatttttgaagacaagcttgcatctgagtaattaatataaaaaag
tgtataaggagattttagaatctcctgaagcaaaactgcttctgggaggaggccagatcc
ccagagactggaattacagagaatgatgaaccaccaggtgggtgctggaaatcaaactca
cggcctatgtgtgagaaacaaacgctttaaaccactgagccaactcactttaagcccaaa
atctactttaaaaccaaaagaacttcttgacagcctaagcagttcgacaagtctacgagg
cagtagaaacaagagaagatcaagactggaccgtgaagcaccaggaactgactaaggtgc
ataatttacccaccaaagcagagctggcctccaggttccccagcgcccccctcagtccct
acctggcataccctgcccccaacagggaactttccagcccaggtgcttgtccgccctccc
ccaagagtctcctcccaatataatccagacatttagtctctgcccttctctctcttcctc
tccttctcttctttctcctccaatgctcccttttgctcccctacccccacccccatggca
atcccatggcctcaatccctggggtcagtgaacctgcccgcctgagagtagcatcccaat
aaacctgtcttcaggtactcc

DBGET integrated database retrieval system