KEGG   Mus musculus (mouse): 77358Help
Entry
77358             CDS       T01002                                 

Gene name
9430069I07Rik
Definition
(RefSeq) RIKEN cDNA 9430069I07 gene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 77358
NCBI-ProteinID: NP_001243090
MGI: 1924608
Ensembl: ENSMUSG00000094447
UniProt: Q9CX21
Position
15; 15 B3.1
AA seq 111 aa AA seqDB search
MSITKAAGSLRISRMGRAQCLTTEMYEPGVLRQKWAQLCSKTLHMWTAAKEDKEGFLGAP
RQTQVLFGMRSSSGKLSWAMKDTPCPHPFFYKENIFPTVLRLMRGEEVLRL
NT seq 336 nt NT seq  +upstreamnt  +downstreamnt
atgtctatcactaaagcagccggatccctgcgtatctctaggatggggcgtgcacaatgc
ttgactactgagatgtacgagccaggtgtgttgaggcagaagtgggcacagttgtgttcc
aagacgctgcacatgtggactgctgcaaaggaagacaaagaaggctttcttggagccccc
aggcagacccaggtgctctttgggatgaggtcctcgtctggaaagctatcctgggctatg
aaggacacaccatgtccacacccattcttctataaggagaacatctttccaacagtcctg
aggctcatgcgtggagaggaagtacttaggctctga

DBGET integrated database retrieval system