KEGG   Meiothermus ruber DSM 1279: Mrub_R0007Help
Entry
Mrub_R0007        tRNA      T01193                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
mrb  Meiothermus ruber DSM 1279
Pathway
mrb00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:mrb00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Mrub_R0007
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:mrb03100]
    Mrub_R0007
Non-coding RNAs [BR:mrb03100]
 Transfer RNA
  tRNA
   Mrub_R0007
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
383516..383592
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggccgttagctcagttggtcagagcaagcgactcataatcgccaggtcgcgggttcaag
tcctgcacggcccacca

DBGET integrated database retrieval system