KEGG   Mycobacterium sp. JS623: Mycsm_06133Help
Entry
Mycsm_06133       tRNA      T02423                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
msa  Mycobacterium sp. JS623
Pathway
msa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:msa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Mycsm_06133
Non-coding RNAs [BR:msa03100]
 Transfer RNA
  tRNA
   Mycsm_06133
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(6089546..6089636)
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggtggcgtgtccgagcggcctaaggagcacgcctcgaaagcgtgtgacgggtaacccccg
tccgagggttcaaatccctccgccaccgcca

DBGET integrated database retrieval system