KEGG   Mycobacterium sp. JS623: Mycsm_06155Help
Entry
Mycsm_06155       tRNA      T02423                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
msa  Mycobacterium sp. JS623
Pathway
msa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:msa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Mycsm_06155
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:msa03100]
    Mycsm_06155
Non-coding RNAs [BR:msa03100]
 Transfer RNA
  tRNA
   Mycsm_06155
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(6107826..6107898)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gcgcccgtagctcaacggatagagcatctgactacggatcagaaggttgggggttcgaat
cccttcgggcgcg

DBGET integrated database retrieval system