KEGG   Methanothrix thermoacetophila: Mthe_1336Help
Entry
Mthe_1336         gene      T00417                                 

Definition
(GenBank) pseudogene
Organism
mtp  Methanothrix thermoacetophila
SSDB OrthologParalogGene clusterGFIT
Position
complement(1441181..1441390)
Genome map
NT seq 210 nt NT seq  +upstreamnt  +downstreamnt
ttccgacagcctgtctctccaaaggtggggccgatacaggagcagcttggcgatataaac
agcaccgcagtaaactactcctcgggcgcaacagaccaggagcttatcgtctcttccaag
gccatgcagtacgaggagtttttcaggaggatcgcggagagctgacaacacaatagcgcc
tggctccgctcttctgtattcagcgactta

DBGET integrated database retrieval system