KEGG   Methanosaeta thermophila: Mthe_1440Help
Entry
Mthe_1440         CDS       T00417                                 

Definition
(GenBank) hypothetical protein
Organism
mtp  Methanosaeta thermophila
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABK15214
UniProt: A0B940
Position
1538864..1539130
Genome map
AA seq 88 aa AA seqDB search
MLTSGFSGTKEDEWLEVLSEIEEIARSSESSVAAHALLHRVEALAKREDVPPELEDRLDM
LLIELTEAARDACTNTKCPHYGKRCKMR
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atgttgacgagcgggttttcaggtaccaaagaggatgagtggctggaggtactgagcgag
attgaggagattgcgaggtcctctgagagcagcgtggctgcacatgcccttctgcatcgg
gtggaggcgcttgcaaaacgtgaagacgtgccgcctgagcttgaggacaggcttgacatg
ctgctgattgagctgacagaggcagcgagagatgcatgcacaaatacgaagtgcccgcat
tacggaaaaagatgcaaaatgcgataa

DBGET integrated database retrieval system