KEGG   Nocardioides sp. JS614: Noca_3628Help
Entry
Noca_3628         CDS       T00443                                 

Definition
(GenBank) conserved hypothetical protein
Organism
nca  Nocardioides sp. JS614
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Polyketide_cyc2 AHSA1 Polyketide_cyc
Motif
Other DBs
NCBI-ProteinID: ABL83128
UniProt: A1SMU3
Position
complement(3846015..3846470)
Genome map
AA seq 151 aa AA seqDB search
MAINTRRMKATPEQVWDVLADGWLYPLWVVGASRMREVDDAWPVVGSQLHHSVGTWPALL
DDSTEVVESTPGSTLVLHARAWPTGAARVTIRLEAVGVETDVSIEEDAVSGPALLIPKPV
RDLQLTWRNSESLRRLAYIAERRSAGRTSAS
NT seq 456 nt NT seq  +upstreamnt  +downstreamnt
atggcgatcaacacccgcaggatgaaggccactcccgagcaggtctgggatgtgctggcc
gacggctggctctacccgctctgggtggtcggcgcctcccggatgcgcgaggtcgacgac
gcctggcccgtggtcggctcgcagctgcaccactcggtcggcacctggccggcgctcctg
gacgacagcaccgaggtggtggagtcgaccccgggctcgacgctggtgctgcacgcccgg
gcctggccgaccggtgccgcccgggtgacgatccggctggaggcggtcggcgtcgagacc
gacgtcagcatcgaggaggacgccgtcagcggccctgcgctcctgatcccgaagccggtt
cgcgacctgcagctgacgtggcgcaactccgagagcctgcggcggctcgcctacatcgcc
gagcgccgcagcgccgggaggacctccgcctcgtag

DBGET integrated database retrieval system