KEGG   Nocardioides sp. JS614: Noca_3724Help
Entry
Noca_3724         CDS       T00443                                 

Definition
(GenBank) putative phosphodiesterase
Organism
nca  Nocardioides sp. JS614
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABL83224
UniProt: A1SN39
Position
complement(3950379..3951047)
Genome map
AA seq 222 aa AA seqDB search
MSALDAPAHALASAGGLLFAGTTRAVAAVRPAAKPLHPRGEVTRGRLFRRGAQPATGVPW
LDETGEDDVLVRRSRAIGLPGSAPDIHGLAIRVPRPGGGHGDLLLASTGWGRLTRFVLTM
SRSPRQRPMTTLLPYRTDRGPLLLGARPTGAESFELAAAAPEGEWARFAELRLSALPLDD
DADDPAVSFDPVVNRLPGLEQYGAVERLREPSYRSARGSRTE
NT seq 669 nt NT seq  +upstreamnt  +downstreamnt
atgtccgctctcgacgcccccgcgcacgccctcgcctccgccggaggcctgctgttcgcc
gggacgacccgcgccgtggccgccgtccggccggccgccaagccgctgcacccacgcgga
gaggtgacccgcggtcggctgttccgtcgcggtgcgcagccggccacgggcgtgccgtgg
ctcgacgagaccggcgaggacgacgtgctggtgcgccgctcccgggcgatcggcctgccc
ggttcggcgcccgacatccatggcctggcgatccgcgtgccccgccccggcggcgggcac
ggcgacctcctgctcgcctcgaccggatggggccggctgacccgcttcgtgctgaccatg
agccgctccccgcggcagcggccgatgaccacgctgctgccctaccggaccgaccggggg
ccgctgctgctcggtgcccggccaaccggcgccgagtccttcgagctggccgcggccgcg
ccggagggggagtgggcgcgcttcgccgagctgcggctgtccgcgttgcccctggacgac
gacgcggacgacccggccgtctcgttcgacccagtggtcaaccggctccccggactcgag
cagtacggcgcggtcgagcggctgcgcgagccgtcgtaccgatccgctcgtggctctcgc
accgaatga

DBGET integrated database retrieval system