KEGG   Candidatus Nitrosopumilus sediminis: NSED_t10085Help
Entry
NSED_t10085       tRNA      T02303                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
nir  Candidatus Nitrosopumilus sediminis
Pathway
nir00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:nir00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    NSED_t10085
Non-coding RNAs [BR:nir03100]
 Transfer RNA
  tRNA
   NSED_t10085
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1104818..1104891
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
gccaatgtagctcagcctggtagagcaattgatttgtaatcaataggtcatgggttcaga
tcccgtcattggct

DBGET integrated database retrieval system