KEGG   Neisseria meningitidis MC58 (serogroup B): NMB0523Help
Entry
NMB0523           gene      T00027                                 

Definition
(RefSeq) pseudogene
Organism
nme  Neisseria meningitidis MC58 (serogroup B)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 902638
Position
544199..544481
Genome map
NT seq 283 nt NT seq  +upstreamnt  +downstreamnt
atgattcacgaagaaatctccgccatgcctatgggctatgaaaccttgatcggcgatatg
ggcagcgcactgtcaggcggacaaaaacaacgcatcgtattggcgcgggccttaatattg
cgaaccgaaaatcctatttttagatgcagcgaccagccatttggatattgccaatgaaaa
agcagtcaatgcaaacttgaatggcttgtctatcataaaaattatggcggcacacagaaa
ggaaacggtggaatcagcagataggaaaatgtctttaggataa

DBGET integrated database retrieval system